cxcl12b

Ensembl ID:
ENSDARG00000055100
ZFIN ID:
ZDB-GENE-030721-1
Description:
chemokine (C-X-C motif) ligand 12b (stromal cell-derived factor 1) [Source:RefSeq peptide;Acc:NP_93
Human Orthologue:
CXCL12
Human Description:
chemokine (C-X-C motif) ligand 12 [Source:HGNC Symbol;Acc:10672]
Mouse Orthologue:
Cxcl12
Mouse Description:
chemokine (C-X-C motif) ligand 12 Gene [Source:MGI Symbol;Acc:MGI:103556]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1516 Nonsense Available for shipment Available now
sa14394 Nonsense Available for shipment Available now
sa24194 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1516
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077411 Nonsense 4 97 1 4
Genomic Location:
Chromosome 22 (position 27567533)
KASP Assay ID:
554-1440.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGCTGTGATCAACAGAACACACACACACTCGCTCTTGGCATGGATAGC[A/T]AAGTAGTAGCGCTGGTGGCGCTGCTGATGCTCGCCTTCTGGAGCCCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14394
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077411 Nonsense 17 97 1 4
Genomic Location:
Chromosome 22 (position 27567492)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGATAGCWAAGTAGTAGCGCTGGTGGCGCTGCTGATGCTCGCCTTCTG[G/A]AGCCCAGAGACTGACGGTAGGACAAYTTTGATTAYATCTGCAAYGGTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24194
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077411 Essential Splice Site 90 97 3 4
Genomic Location:
Chromosome 22 (position 27558454)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCAAAGACCAAATGGCTTCAGCAGTATCTAAAGAATGCCCTTAACAAG[T/C]AAGGAGAAACTTTTATTCCGGGGTTTCATGAGAATCACCAGTCCTTAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2nbhs6en