fam184b

Ensembl ID:
ENSDARG00000055099
ZFIN ID:
ZDB-GENE-090313-380
Human Orthologue:
FAM184B
Human Description:
family with sequence similarity 184, member B [Source:HGNC Symbol;Acc:29235]
Mouse Orthologue:
Fam184b
Mouse Description:
family with sequence similarity 184, member B Gene [Source:MGI Symbol;Acc:MGI:2442958]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32672 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24844 Nonsense Mutation detected in F1 DNA During 2016
sa16579 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32672
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077394 Essential Splice Site 114 1165 3 19
ENSDART00000145942 Essential Splice Site 54 1105 2 18
Genomic Location (Zv9):
Chromosome 1 (position 22310332)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22845499
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAAGATGAATAGATTCACTTTCTTTAACCTGGCAAATGTATCCATCTT[A/C]GGTGGAGGAGCGTGGACAGAGGGCTGAAATAGAGTATGCAGAGCGCATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24844
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077394 Nonsense 548 1165 7 19
ENSDART00000145942 Nonsense 488 1105 6 18
Genomic Location (Zv9):
Chromosome 1 (position 22300740)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22835907
KASP Assay ID:
554-7814.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACTGAAGAAGACAGAAAGCTTTTAGAGACAGAGAGGGAAGAGCTGTG[C/A]AACCAGCTACAACTGTCCAAAACAGAGGTAAGTTATCACAATGTATGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16579
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077394 Nonsense 793 1165 12 19
ENSDART00000145942 Nonsense 733 1105 11 18
Genomic Location (Zv9):
Chromosome 1 (position 22295819)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22830986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGCGGGGGTGGCGTGAGCGAGAGGAGGAGCTGTTGCGTGTGGAGAGGT[T/A]AAATCACCAGCGAGCTCTTCAGRTCCTGRAAACACAAGCCAATGAAGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link