fam184b

Ensembl ID:
ENSDARG00000055099
ZFIN ID:
ZDB-GENE-090313-380
Human Orthologue:
FAM184B
Human Description:
family with sequence similarity 184, member B [Source:HGNC Symbol;Acc:29235]
Mouse Orthologue:
Fam184b
Mouse Description:
family with sequence similarity 184, member B Gene [Source:MGI Symbol;Acc:MGI:2442958]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24844 Nonsense Mutation detected in F1 DNA During 2014
sa16579 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24844
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077394 Nonsense 548 1165 7 19
ENSDART00000145942 Nonsense 488 1105 6 18
Genomic Location:
Chromosome 1 (position 22300740)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACTGAAGAAGACAGAAAGCTTTTAGAGACAGAGAGGGAAGAGCTGTG[C/A]AACCAGCTACAACTGTCCAAAACAGAGGTAAGTTATCACAATGTATGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16579
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077394 Nonsense 793 1165 12 19
ENSDART00000145942 Nonsense 733 1105 11 18
Genomic Location:
Chromosome 1 (position 22295819)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGCGGGGGTGGCGTGAGCGAGAGGAGGAGCTGTTGCGTGTGGAGAGGT[T/A]AAATCACCAGCGAGCTCTTCAGRTCCTGRAAACACAAGCCAATGAAGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uf59ga2x