ENSDARG00000055093

Ensembl ID:
ENSDARG00000055093
Human Orthologue:
CDH26
Human Description:
cadherin 26 [Source:HGNC Symbol;Acc:15902]
Mouse Orthologue:
Cdh26
Mouse Description:
cadherin-like 26 Gene [Source:MGI Symbol;Acc:MGI:2685856]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21845 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21845
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077406 Nonsense 466 813 10 17
Genomic Location:
Chromosome 11 (position 7101226)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCAGATGACCATCCTCCAATGACAAGCACTGCCACGATTCAGCTCTA[T/A]GTGGAAGACAAGAATGATAACGTCCCCTTGCTAAAGGAAAACAGAGTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qthr3184