por

Ensembl ID:
ENSDARG00000055092
ZFIN ID:
ZDB-GENE-050809-121
Description:
NADPH--cytochrome P450 reductase [Source:RefSeq peptide;Acc:NP_001030154]
Human Orthologue:
POR
Human Description:
P450 (cytochrome) oxidoreductase [Source:HGNC Symbol;Acc:9208]
Mouse Orthologue:
Por
Mouse Description:
P450 (cytochrome) oxidoreductase Gene [Source:MGI Symbol;Acc:MGI:97744]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4381 Nonsense F2 line generated During 2017
sa21780 Nonsense Available for shipment Available now
sa38807 Nonsense Mutation detected in F1 DNA During 2017
sa41702 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13459 Essential Splice Site Available for shipment Available now
sa9088 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa4381
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077404 Nonsense 150 674 5 16

The following transcripts of ENSDARG00000055092 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 36317802)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35350504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGCAACCTATGGAGAGGGAGACCCTACAGACAACGCTCAGGAGTTCTA[T/A]GATTGGTTGCAAGGGACAGATGACGATCTGGAGGGGGTTAATTTTGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21780
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077404 Nonsense 258 674 8 16

The following transcripts of ENSDARG00000055092 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 36323889)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35356591
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTGAACTGGTGGTTCATAATGACATCAATATGAATCAAGTGTACACC[G/T]GAGAGATGGGCCGCCTCAAAAGCTTTCAGACGCAGAAACCGTAAGTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38807
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077404 Nonsense 425 674 12 16

The following transcripts of ENSDARG00000055092 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 36327682)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35360384
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTAGGCTCTCTACCAAAGTTGGGTTCTGGATTCGGAGAGGAACATAT[T/A]GGCTATTCTAGAGGATCTGCCTTCGCTGAATCCTCCTATAGATCACCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41702
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077404 Essential Splice Site 598 674 14 16
ENSDART00000077404 Essential Splice Site 598 674 14 16

The following transcripts of ENSDARG00000055092 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 36332962)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35365664
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGCTGACGCAGCTTAACGTGGCCTTTTCCAGAGACCAGGAGCAAAAGG[T/C]GAACCAATTCATGGAAAATAATGATACAAATGTTATTGTGTTATTGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13459
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077404 Essential Splice Site 598 674 14 16
ENSDART00000077404 Essential Splice Site 598 674 14 16

The following transcripts of ENSDARG00000055092 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 36332962)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35365664
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTGCTGACGCAGCTTAACGTGGCCTTTTCCAGAGACCAGGAGCAAAAGG[T/G]RAACYAATTCATGGAAAATAATGATACAAATRTTATTGTGTTATTGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9088
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077404 Nonsense 600 674 15 16

The following transcripts of ENSDARG00000055092 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 36333322)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35366024
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCAGAAATTTGAGTCCTTTTATGTACTGGGCTGTTTTTCGCAGGTCTA[T/A]GTGCAGCATCTTCTGAAGAAAAACAAGCAGCAGTTGTGGAAGCTCATCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link