Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
por
- Ensembl ID:
- ENSDARG00000055092
- ZFIN ID:
- ZDB-GENE-050809-121
- Description:
- NADPH--cytochrome P450 reductase [Source:RefSeq peptide;Acc:NP_001030154]
- Human Orthologue:
- POR
- Human Description:
- P450 (cytochrome) oxidoreductase [Source:HGNC Symbol;Acc:9208]
- Mouse Orthologue:
- Por
- Mouse Description:
- P450 (cytochrome) oxidoreductase Gene [Source:MGI Symbol;Acc:MGI:97744]
Alleles
There are 6 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa4381 | Nonsense | F2 line generated | During 2018 |
| sa21780 | Nonsense | Available for shipment | Available now |
| sa38807 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa41702 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa13459 | Essential Splice Site | Available for shipment | Available now |
| sa9088 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa4381
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000077404 | Nonsense | 150 | 674 | 5 | 16 |
The following transcripts of ENSDARG00000055092 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 10 (position 36317802)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 35350504 GRCz11 10 35294364 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATGGCAACCTATGGAGAGGGAGACCCTACAGACAACGCTCAGGAGTTCTA[T/A]GATTGGTTGCAAGGGACAGATGACGATCTGGAGGGGGTTAATTTTGCTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21780
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000077404 | Nonsense | 258 | 674 | 8 | 16 |
The following transcripts of ENSDARG00000055092 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 10 (position 36323889)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 35356591 GRCz11 10 35300451 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTTTGAACTGGTGGTTCATAATGACATCAATATGAATCAAGTGTACACC[G/T]GAGAGATGGGCCGCCTCAAAAGCTTTCAGACGCAGAAACCGTAAGTTCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38807
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000077404 | Nonsense | 425 | 674 | 12 | 16 |
The following transcripts of ENSDARG00000055092 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 10 (position 36327682)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 35360384 GRCz11 10 35304244 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTTTAGGCTCTCTACCAAAGTTGGGTTCTGGATTCGGAGAGGAACATAT[T/A]GGCTATTCTAGAGGATCTGCCTTCGCTGAATCCTCCTATAGATCACCTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41702
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000077404 | Essential Splice Site | 598 | 674 | 14 | 16 |
| ENSDART00000077404 | Essential Splice Site | 598 | 674 | 14 | 16 |
The following transcripts of ENSDARG00000055092 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 10 (position 36332962)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 35365664 GRCz11 10 35309524 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGTGCTGACGCAGCTTAACGTGGCCTTTTCCAGAGACCAGGAGCAAAAGG[T/C]GAACCAATTCATGGAAAATAATGATACAAATGTTATTGTGTTATTGCTGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13459
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000077404 | Essential Splice Site | 598 | 674 | 14 | 16 |
| ENSDART00000077404 | Essential Splice Site | 598 | 674 | 14 | 16 |
The following transcripts of ENSDARG00000055092 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 10 (position 36332962)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 35365664 GRCz11 10 35309524 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CGTGCTGACGCAGCTTAACGTGGCCTTTTCCAGAGACCAGGAGCAAAAGG[T/G]RAACYAATTCATGGAAAATAATGATACAAATRTTATTGTGTTATTGCTGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9088
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000077404 | Nonsense | 600 | 674 | 15 | 16 |
The following transcripts of ENSDARG00000055092 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 10 (position 36333322)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 35366024 GRCz11 10 35309884 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GATCAGAAATTTGAGTCCTTTTATGTACTGGGCTGTTTTTCGCAGGTCTA[T/A]GTGCAGCATCTTCTGAAGAAAAACAAGCAGCAGTTGTGGAAGCTCATCCA
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
