mab21l1

Ensembl ID:
ENSDARG00000055089
ZFIN ID:
ZDB-GENE-020516-1
Description:
Protein mab-21-like 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6NYB4]
Human Orthologue:
MAB21L1
Human Description:
mab-21-like 1 (C. elegans) [Source:HGNC Symbol;Acc:6757]
Mouse Orthologue:
Mab21l1
Mouse Description:
mab-21-like 1 (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1333773]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42589 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42589
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077405 Nonsense 107 359 1 1
Genomic Location (Zv9):
Chromosome 15 (position 32802895)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 33213656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGACGGCTCTCTGCCGGGCTGCGCCGTGCTCAAGCTCAGCGACGGGCGG[A/T]AGAGAAGTATGTCTCTCTGGGTAGAGTTCATCACGGCTTCGGGATACCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link