ggnbp2

Ensembl ID:
ENSDARG00000055086
ZFIN ID:
ZDB-GENE-060929-52
Description:
gametogenetin-binding protein 2 [Source:RefSeq peptide;Acc:NP_001073430]
Human Orthologue:
GGNBP2
Human Description:
gametogenetin binding protein 2 [Source:HGNC Symbol;Acc:19357]
Mouse Orthologue:
Ggnbp2
Mouse Description:
gametogenetin binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2387356]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18795 Nonsense Mutation detected in F1 DNA During 2014
sa9478 Nonsense Available for shipment Available now
sa17293 Missense, Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18795
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077399 Nonsense 72 681 4 14
ENSDART00000105832 None None 350 None 11
ENSDART00000112134 Nonsense 72 679 3 15
ENSDART00000113627 None None 354 None 11
ENSDART00000121415 Nonsense 105 708 4 13
ENSDART00000077399 Nonsense 72 681 4 14
ENSDART00000105832 None None 350 None 11
ENSDART00000112134 Nonsense 72 679 3 15
ENSDART00000113627 None None 354 None 11
ENSDART00000121415 Nonsense 105 708 4 13

The following transcripts of ENSDARG00000055086 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 4032029)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCTCCAGCATCACAGCATGCTAAAGCAGCAGGACCTGAACATGGCGT[T/A]GATGGTGATGTCACGCGAAGTGTTCAACGCTCTGTCTCAGTCGGTGCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9478
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077399 Nonsense 72 681 4 14
ENSDART00000105832 None None 350 None 11
ENSDART00000112134 Nonsense 72 679 3 15
ENSDART00000113627 None None 354 None 11
ENSDART00000121415 Nonsense 105 708 4 13
ENSDART00000077399 Nonsense 72 681 4 14
ENSDART00000105832 None None 350 None 11
ENSDART00000112134 Nonsense 72 679 3 15
ENSDART00000113627 None None 354 None 11
ENSDART00000121415 Nonsense 105 708 4 13

The following transcripts of ENSDARG00000055086 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 4032029)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCTCCAGCATCACAGCATGCTAAAGCAGCAGGACCTGAACATGGCGT[T/A]GATGGTGATGTCRCGYGAAGTGTTCAACGCTCTGTCTCAGTCGGTGCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17293
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Missense, Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077399 None 537 681 12 14
ENSDART00000105832 Missense 321 350 9 11
ENSDART00000112134 Splice Site, Nonsense 528 679 12 15
ENSDART00000113627 None 210 354 9 11
ENSDART00000121415 None 570 708 12 13

The following transcripts of ENSDARG00000055086 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 4054329)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCTGAAGACAGCACAAAGGGCAAAAACAAAAAGAAGAAAAGAAAAAA[C/T]AAGGGCACACTTTGCAGAAAYGAGATCGTGAGTTGTTNNTNNNNTGTNNNTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vu5fnph0