chac2

Ensembl ID:
ENSDARG00000055078
ZFIN ID:
ZDB-GENE-050706-146
Description:
Cation transport regulator-like protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q4KMJ1]
Human Orthologue:
CHAC2
Human Description:
ChaC, cation transport regulator homolog 2 (E. coli) [Source:HGNC Symbol;Acc:32363]
Mouse Orthologue:
Chac2
Mouse Description:
ChaC, cation transport regulator homolog 2 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1915294]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22098 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22098
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050831 Essential Splice Site 45 182 1 3
Genomic Location:
Chromosome 12 (position 25569943)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCCGGTTCTGGCAGGGAAGTACGGATCATCGAGGAGTTCCTGGAAAGG[T/A]AATTTCGACATTAAAGTCCTCCGGGTTGATCAACAGTCCGCAGGTGTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7cfsgd50