nxf1

Ensembl ID:
ENSDARG00000055076
ZFIN ID:
ZDB-GENE-030131-2585
Description:
Nxf1 protein [Source:UniProtKB/TrEMBL;Acc:Q5CZT0]
Human Orthologues:
NXF1, NXF2, NXF2B, NXF3, NXF5
Human Descriptions:
nuclear RNA export factor 1 [Source:HGNC Symbol;Acc:8071]
nuclear RNA export factor 2 [Source:HGNC Symbol;Acc:8072]
nuclear RNA export factor 2B [Source:HGNC Symbol;Acc:23984]
nuclear RNA export factor 3 [Source:HGNC Symbol;Acc:8073]
nuclear RNA export factor 5 [Source:HGNC Symbol;Acc:8075]
Mouse Orthologues:
Nxf1, Nxf2, Nxf3, Nxf7
Mouse Descriptions:
nuclear RNA export factor 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1858330]
nuclear RNA export factor 2 Gene [Source:MGI Symbol;Acc:MGI:1933192]
nuclear RNA export factor 3 Gene [Source:MGI Symbol;Acc:MGI:2685230]
nuclear RNA export factor 7 Gene [Source:MGI Symbol;Acc:MGI:2159343]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23951 Nonsense Available for shipment Available now
sa43658 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23951
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077381 Nonsense 299 642 9 21
Genomic Location (Zv9):
Chromosome 21 (position 26066350)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26636168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTTACCCCATTCATAGCTGGTTTGTCTAAACCTAAGTAACAACCGGT[T/A]ATTCAGGCTGGATGACCTGGTGGATATTATCCACAAAGTTCCCAACCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43658
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077381 Essential Splice Site 324 642 9 21
Genomic Location (Zv9):
Chromosome 21 (position 26066272)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26636090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCCACAAAGTTCCCAACCTAAAAATTCTCAATCTGTCACACAATGAGG[T/A]ATGAATGTGCTCTCTGATGCCTGTAGATTTATCTTGCTACCTGTAATTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link