NP_001030338.2

Ensembl ID:
ENSDARG00000055075
Description:
supervillin [Source:RefSeq peptide;Acc:NP_001030338]
Human Orthologue:
SVIL
Human Description:
supervillin [Source:HGNC Symbol;Acc:11480]
Mouse Orthologue:
Svil
Mouse Description:
supervillin Gene [Source:MGI Symbol;Acc:MGI:2147319]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12766 Essential Splice Site Available for shipment Available now
sa17102 Nonsense Available for shipment Available now
sa14853 Nonsense Mutation detected in F1 DNA During 2017
sa38892 Nonsense Mutation detected in F1 DNA During 2017
sa14626 Essential Splice Site Available for shipment Available now
sa14627 Essential Splice Site Available for shipment Available now
sa17252 Nonsense Available for shipment Available now
sa11202 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12766
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066331 Essential Splice Site 3 1763 4 38
ENSDART00000077314 Essential Splice Site None 768 4 37
ENSDART00000089814 Essential Splice Site 3 1642 4 36
Genomic Location (Zv9):
Chromosome 12 (position 25288817)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23745157
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAAACGTTTTGAAAGTATAAGCACAAGTCAGAGTTGGGACATGAACAG[G/A]TGAGAAGTTAAATCATTCTCCTAAAGCCTGCACAGCCAAAGTTCAGTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17102
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066331 Nonsense 127 1763 6 38
ENSDART00000077314   None 768 6 37
ENSDART00000089814 Nonsense 127 1642 6 36
Genomic Location (Zv9):
Chromosome 12 (position 25293135)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23749475
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGCRGAGCGCTATGGCATCKCTCTAGATCAGGAGATGGAAACAGACTA[T/A]ACAACTCGCTTCTCCAGACCCTCCAGAGAGCTTGATGGTTYAGACAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14853
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066331 Nonsense 207 1763 6 38
ENSDART00000077314   None 768 6 37
ENSDART00000089814 Nonsense 207 1642 6 36
Genomic Location (Zv9):
Chromosome 12 (position 25293373)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23749713
KASP Assay ID:
1641-0482.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAAAGAATGATGAATCTGGAGAACCAGAGGAGGGCACAGGAGCGTGAC[C/T]GATTACATGGAGGTGGAGGGGTTGCACCTGACCCATCTGCGTATATGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38892
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066331 Nonsense 248 1763 6 38
ENSDART00000077314   None 768 6 37
ENSDART00000089814 Nonsense 248 1642 6 36
Genomic Location (Zv9):
Chromosome 12 (position 25293496)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23749836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAAGGGAGCCAGGGATGATGGGAGTTCCCAGCTCACCCAATTCAGGC[C/T]GAAGGGGCTTGATGCTCTCTCCCAAACAGGGAGCGTCTCCTGGTGATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14626
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066331 Essential Splice Site 290 1763 None 38
ENSDART00000077314 Essential Splice Site None 768 None 37
ENSDART00000089814 Essential Splice Site 290 1642 None 36
Genomic Location (Zv9):
Chromosome 12 (position 25302085)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23758425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAAGSCTTCTGACTCATTCTTTTTCTTCTATTCTTTTTGTGTTTTTCC[A/T]KTGGATGAAGAGAAACTAGATGAGAGAGCAAAGCTGAGCGTAGCTGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14627
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066331 Essential Splice Site 290 1763 8 38
ENSDART00000077314 Essential Splice Site None 768 8 37
ENSDART00000089814 Essential Splice Site 290 1642 8 36
Genomic Location (Zv9):
Chromosome 12 (position 25302086)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23758426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGSCTTCTGACTCATTCTTTTTCTTCTATTCTTTTTGTGTTTTTCCW[G/T]TGGATGAAGAGAAACTAGATGAGAGAGCAAAGCTGAGCGTAGCTGCCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17252
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066331 Nonsense 1016 1763 22 38
ENSDART00000077314 Nonsense 28 768 22 37
ENSDART00000089814 Nonsense 1016 1642 22 36
Genomic Location (Zv9):
Chromosome 12 (position 25331889)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23788229
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGACCAGACTGGTTGAGCCCAGAGCTTNYTCCTTGAACAGTGGCGACTG[C/A]TTCCTCCTGATCACACCACATYATTGCTTCATCTGGATTGGAGAATTCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11202
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066331 Nonsense 1088 1763 23 38
ENSDART00000077314 Nonsense 100 768 23 37
ENSDART00000089814 Nonsense 1088 1642 23 36
Genomic Location (Zv9):
Chromosome 12 (position 25334595)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23790935
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACACGCTGCCAAAGACTTTTGGAAGATTCTCGGTGGCCAAACCAGTTA[T/A]CAGTGTAAGTTTGGCTTTAATTACTTTCATTAGTTTTCATCTGCTGACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link