C9orf4

Ensembl ID:
ENSDARG00000055069
Description:
chromosome 9 open reading frame 4 [Source:HGNC Symbol;Acc:1362]
Human Orthologue:
C9orf4
Human Description:
chromosome 9 open reading frame 4 [Source:HGNC Symbol;Acc:1362]
Mouse Orthologue:
6430704M03Rik
Mouse Description:
RIKEN cDNA 6430704M03 gene Gene [Source:MGI Symbol;Acc:MGI:2442704]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32093 Nonsense Mutation detected in F1 DNA During 2016
sa7791 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32093
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077376 Nonsense 90 282 2 5
Genomic Location:
Chromosome 16 (position 29428447)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACTGCACCCCCTGTGGACCCATTTGCCCGCATCAAAGTCAGCGACTGT[G/T]GAGTAACCAAAGGATGCATCAGGTCTGTGCATGCAATGAAGGTTTATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7791
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077376 Nonsense 165 282 4 5
Genomic Location:
Chromosome 16 (position 29428955)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGGCTGTGTTCMTGATGATAACGGACGWGTACGGATCCATCATTTCTA[T/A]AATGTGGGCCAGTGGGCCAAAGAAATCAAGMGCAACCCAGCACGGGATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link