bcl9l

Ensembl ID:
ENSDARG00000055054
ZFIN ID:
ZDB-GENE-040927-29
Description:
B-cell CLL/lymphoma 9-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q67FY3]
Human Orthologue:
BCL9L
Human Description:
B-cell CLL/lymphoma 9-like [Source:HGNC Symbol;Acc:23688]
Mouse Orthologue:
Bcl9l
Mouse Description:
B-cell CLL/lymphoma 9-like Gene [Source:MGI Symbol;Acc:MGI:1933114]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36718 Nonsense Mutation detected in F1 DNA During 2017
sa39214 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36718
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077357 Nonsense 539 1531 7 9
Genomic Location (Zv9):
Chromosome 18 (position 42300776)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 43906148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTAGCATGGAGGAAGCTACAAGAAGAATACTACCAGGAGAAAAGGCGA[C/T]AACATGATATGAACCCCCACCAGCATCCCCAGCATTTCCGCATAATGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39214
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077357 Nonsense 880 1531 7 9
Genomic Location (Zv9):
Chromosome 18 (position 42299752)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 43905124
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATATGTATGGACCAGACCAGCCAGGTCCTCCCCATCTGAGCAGCACTT[C/A]GAGACTTAGTCACATTCCCATGAACACTGGATCAAGGGTTACAGACCTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link