bcl9l

Ensembl ID:
ENSDARG00000055054
ZFIN ID:
ZDB-GENE-040927-29
Description:
B-cell CLL/lymphoma 9-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q67FY3]
Human Orthologue:
BCL9L
Human Description:
B-cell CLL/lymphoma 9-like [Source:HGNC Symbol;Acc:23688]
Mouse Orthologue:
Bcl9l
Mouse Description:
B-cell CLL/lymphoma 9-like Gene [Source:MGI Symbol;Acc:MGI:1933114]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36718 Nonsense Mutation detected in F1 DNA During 2017
sa44897 Nonsense Mutation detected in F1 DNA During 2017
sa39214 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36718
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077357 Nonsense 539 1531 7 9
Genomic Location (Zv9):
Chromosome 18 (position 42300776)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 43906148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTAGCATGGAGGAAGCTACAAGAAGAATACTACCAGGAGAAAAGGCGA[C/T]AACATGATATGAACCCCCACCAGCATCCCCAGCATTTCCGCATAATGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077357 Nonsense 582 1531 7 9
Genomic Location (Zv9):
Chromosome 18 (position 42300647)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGATGAGGGGTCCTCCACCACCATATCATAGTAAACCTGGTGATCAG[C/T]AGTGGGGGCCTGGTCCAATGGTAGGGGGAGGAATGGGAGGGAATGCACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39214
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077357 Nonsense 880 1531 7 9
Genomic Location (Zv9):
Chromosome 18 (position 42299752)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 43905124
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATATGTATGGACCAGACCAGCCAGGTCCTCCCCATCTGAGCAGCACTT[C/A]GAGACTTAGTCACATTCCCATGAACACTGGATCAAGGGTTACAGACCTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link