LOC564761

Ensembl ID:
ENSDARG00000055053
Human Orthologues:
ITIH1, ITIH3
Human Descriptions:
inter-alpha (globulin) inhibitor H1 [Source:HGNC Symbol;Acc:6166]
inter-alpha (globulin) inhibitor H3 [Source:HGNC Symbol;Acc:6168]
Mouse Orthologues:
Itih1, Itih3
Mouse Descriptions:
inter-alpha trypsin inhibitor, heavy chain 1 Gene [Source:MGI Symbol;Acc:MGI:96618]
inter-alpha trypsin inhibitor, heavy chain 3 Gene [Source:MGI Symbol;Acc:MGI:96620]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12713 Essential Splice Site Available for shipment Available now
sa41764 Nonsense Mutation detected in F1 DNA During 2016
sa31810 Nonsense Available for shipment Available now
sa21835 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12713
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077344 Essential Splice Site 123 905 3 21
Genomic Location (Zv9):
Chromosome 11 (position 3706364)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3624868
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAGTATGAGAGCGCTGTRATATCCGGTCAAACTGCTGGCCTGGTTAA[G/A]TAAGTACAGATCAACGCTGAATTTCTGGCATGCTAACTAAGTACACGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41764
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077344 Nonsense 720 905 18 21
Genomic Location (Zv9):
Chromosome 11 (position 3694743)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3613247
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATCATCGGAGATAAGAAGATCATCCCAGGGAGCAAGTTGCACACTTA[T/A]TTTGGCCGCTTTGGGATTGTTGATGAGAAATTGGGTATCAGACTGATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31810
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077344 Nonsense 734 905 18 21
Genomic Location (Zv9):
Chromosome 11 (position 3694703)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3613207
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACACTTATTTTGGCCGCTTTGGGATTGTTGATGAGAAATTGGGTATC[A/T]GACTGATGGTGAGCACACAGGAGATCTGGGTGTCCGAAGGAGGAAAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21835
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077344 Essential Splice Site 823 905 20 21
Genomic Location (Zv9):
Chromosome 11 (position 3693269)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3611773
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTAATCCTGAAGTTACCAACAGTTTCATTTGGTGTCAAATTTTAATGC[A/T]GGTCAATTCTACCACGGCATAAACTTTGAGGTCAGTGACTTATTTCCAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link