LOC564761

Ensembl ID:
ENSDARG00000055053
Human Orthologues:
ITIH1, ITIH3
Human Descriptions:
inter-alpha (globulin) inhibitor H1 [Source:HGNC Symbol;Acc:6166]
inter-alpha (globulin) inhibitor H3 [Source:HGNC Symbol;Acc:6168]
Mouse Orthologues:
Itih1, Itih3
Mouse Descriptions:
inter-alpha trypsin inhibitor, heavy chain 1 Gene [Source:MGI Symbol;Acc:MGI:96618]
inter-alpha trypsin inhibitor, heavy chain 3 Gene [Source:MGI Symbol;Acc:MGI:96620]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3795 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2618 Nonsense Mutation detected in F1 DNA During 2014
sa12713 Essential Splice Site Available for shipment Available now
sa3786 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21835 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa3795
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077344 Essential Splice Site 36 905 1 21
Genomic Location:
Chromosome 11 (position 3708688)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAAGCTCAAGTCACAATCAAAGWTGACAGCAACAACTCTGCAAAACAG[G/A]TATGGTTTATCAATTCTGTGCTTCAGTGCATTTATGCGTTTTATTTTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2618
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077344 Nonsense 46 905 2 21
Genomic Location:
Chromosome 11 (position 3706673)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCRWACTATGTTTCTCTCAGATTGAACTGCAAAGCATGCGAGTGGACTG[C/A]AAGGTTGCGTCTCGTTTTGCTCACACYGTCATGACCACCAGAGCACTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12713
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077344 Essential Splice Site 123 905 3 21
Genomic Location:
Chromosome 11 (position 3706364)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAGTATGAGAGCGCTGTRATATCCGGTCAAACTGCTGGCCTGGTTAA[G/A]TAAGTACAGATCAACGCTGAATTTCTGGCATGCTAACTAAGTACACGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3786
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077344 Essential Splice Site 659 905 16 21
Genomic Location:
Chromosome 11 (position 3696220)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGAAGGTGGCACTGCTTCCCAAAGAAGGTTRACWCCTTCATCTTTAG[G/A]TAAGAAGAGCATAGTTTGGAAAAATCTAAAGAGTAGAGAAAAANCTTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21835
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077344 Essential Splice Site 823 905 20 21
Genomic Location:
Chromosome 11 (position 3693269)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTAATCCTGAAGTTACCAACAGTTTCATTTGGTGTCAAATTTTAATGC[A/T]GGTCAATTCTACCACGGCATAAACTTTGAGGTCAGTGACTTATTTCCAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/awp0bxdr