si:dkey-165a24.3

Ensembl ID:
ENSDARG00000055046
ZFIN ID:
ZDB-GENE-081104-325
Human Orthologues:
CNFN, PLAC8L1
Human Descriptions:
cornifelin [Source:HGNC Symbol;Acc:30183]
PLAC8-like 1 [Source:HGNC Symbol;Acc:31746]
Mouse Orthologues:
Cnfn, Plac8l1
Mouse Descriptions:
cornifelin Gene [Source:MGI Symbol;Acc:MGI:1919633]
PLAC8-like 1 Gene [Source:MGI Symbol;Acc:MGI:1916651]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26942 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26942
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077352 Essential Splice Site 35 127 1 3
ENSDART00000141048 Essential Splice Site 31 123 2 4

The following transcripts of ENSDARG00000055046 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 23826520)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 22388272
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACCAGTGGAGCTCTGGAATCTGCGACTGCTGTGACAATGTGCCCGAGT[G/A]TGAGTCTCTCTCACTCATTCTTTCAGTCTTGTTGATTTTGGTGTGTCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link