casp3b

Ensembl ID:
ENSDARG00000055045
ZFIN ID:
ZDB-GENE-070607-1
Description:
caspase 3, apoptosis-related cysteine protease b [Source:RefSeq peptide;Acc:NP_001041531]
Human Orthologue:
CASP3
Human Description:
caspase 3, apoptosis-related cysteine peptidase [Source:HGNC Symbol;Acc:1504]
Mouse Orthologue:
Casp3
Mouse Description:
caspase 3 Gene [Source:MGI Symbol;Acc:MGI:107739]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15886 Essential Splice Site Available for shipment Available now
sa22414 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15886
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077348 Essential Splice Site 21 285 1 6
Genomic Location:
Chromosome 14 (position 4321540)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCAAAGGGTGWAGACACTGTGGATGCCAGACAAAGCGATGCAAAASAG[T/A]ATGTGTGATTGATTCATTAAAAGACTCTTGTTAATTACAAGCATATCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22414
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077348 Essential Splice Site 69 285 2 6
Genomic Location:
Chromosome 14 (position 4316281)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTAGGACAATGTCTCATCATCAACAACAAGAATTTCCACAAAAGAACAG[G/A]TACATTGATATATAACACTGTGCTCATTATATAAGCAAAAAGAGCAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pxotdyq6