nkrf

Ensembl ID:
ENSDARG00000055040
ZFIN ID:
ZDB-GENE-030616-73
Description:
Similar to NF-kappa-B-repressing factor (NFkB-repressing factor) (Transcription factor NRF) (ITBA4 p
Human Orthologues:
CDKN2AIPNL, NKRF
Human Descriptions:
CDKN2A interacting protein N-terminal like [Source:HGNC Symbol;Acc:30545]
NFKB repressing factor [Source:HGNC Symbol;Acc:19374]
Mouse Orthologues:
Cdkn2aipnl, Nkrf
Mouse Descriptions:
CDKN2A interacting protein N-terminal like Gene [Source:MGI Symbol;Acc:MGI:1261797]
NF-kappaB repressing factor Gene [Source:MGI Symbol;Acc:MGI:1924536]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16364 Nonsense Available for shipment Available now
sa16160 Nonsense Available for shipment Available now
sa31995 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16364
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077336 Nonsense 396 858 3 3
ENSDART00000077336 Nonsense 396 858 3 3
Genomic Location (Zv9):
Chromosome 14 (position 33713835)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 32516845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTGACCTTCCTAAAAACAGAAAGGTACCATGTGATGGATATGCGTGT[G/T]AACTGAGGTGTCAGAGTGTATACCTTGCTACAGGTTACTCTGGGAGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16160
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077336 Nonsense 396 858 3 3
ENSDART00000077336 Nonsense 396 858 3 3
Genomic Location (Zv9):
Chromosome 14 (position 33713835)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 32516845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTGACCTTCCTAAAAACAGAAAGGTACCATGTGATGGATATGCGTGT[G/T]AACTGAGGTGTCAGAGTGTATACCTTGCTACAGGTTACTCTGGGAGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31995
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077336 Nonsense 569 858 3 3
Genomic Location (Zv9):
Chromosome 14 (position 33714354)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCAGAGGAGGCAGTGAAGAAGTTGCGAATGAACCAAGCTGCTCGCCAA[C/T]AAGAGCAGCAGCAGCAGCAGCAACAACAACAACAACAATTTTCTGGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link