pomt2

Ensembl ID:
ENSDARG00000055027
ZFIN ID:
ZDB-GENE-070112-1002
Description:
protein O-mannosyl-transferase 2 [Source:RefSeq peptide;Acc:NP_001038498]
Human Orthologue:
POMT2
Human Description:
protein-O-mannosyltransferase 2 [Source:HGNC Symbol;Acc:19743]
Mouse Orthologue:
Pomt2
Mouse Description:
protein-O-mannosyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:2444430]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
hu3612 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
hu3612
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077307 Nonsense 180 756 4 21
ENSDART00000126273 Nonsense 180 756 5 22

The following transcripts of ENSDARG00000055027 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 31768477)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 31692404
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTTGCCTCCTTTTGCCTTTCTTGTTGTCCTGGAGCTCTCTCAGTCTT[C/G]AACAGCAGCGCTCATCGCAGCCTCTCTGCTCATCTTCGGTGAGTGCAGCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link