ptch2

Ensembl ID:
ENSDARG00000055026
ZFIN ID:
ZDB-GENE-980526-44
Description:
Protein patched homolog 1 [Source:UniProtKB/Swiss-Prot;Acc:Q98864]
Human Orthologue:
PTCH2
Human Description:
patched 2 [Source:HGNC Symbol;Acc:9586]
Mouse Orthologue:
Ptch2
Mouse Description:
patched homolog 2 Gene [Source:MGI Symbol;Acc:MGI:1095405]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19807 Nonsense Available for shipment Available now
sa38340 Nonsense Mutation detected in F1 DNA During 2017
sa39869 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19807
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077304 Nonsense 171 1442 3 22
ENSDART00000140910 Nonsense 171 1383 3 21
Genomic Location (Zv9):
Chromosome 2 (position 33701581)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 34000488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACCCAGGAGGCTTTGCTGCTCCACCTGGAGGCAGCTCTGTCAGCTAGC[A/T]AAGTTCAAGTGTCTCTTTATGGAAAGTGAGTACAACCACCAGCAACAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38340
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077304 Nonsense 515 1442 11 22
ENSDART00000140910 Nonsense 515 1383 11 21
Genomic Location (Zv9):
Chromosome 2 (position 33696627)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 33995534
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCTTGTTGGCTCATTCCTTCACAGAGACCCGATCCAACATCCCATTC[A/T]AGGCATGTATCTCATGAGCATGCTCTGGATCATGACTTTTAAACTCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39869
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077304 Essential Splice Site 1431 1442 21 22
ENSDART00000140910   None 1383 None 21
Genomic Location (Zv9):
Chromosome 2 (position 33687398)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 33986305
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCTGAATTCCACAGAAAAAGACCCACATCAAGCTAACCAGATGCTAG[G/T]TAAATAGCATTATATTTAAATCATCAAAACTAGACATTTGTATTTTTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link