pds5a

Ensembl ID:
ENSDARG00000055022
ZFIN ID:
ZDB-GENE-040426-1612
Description:
Sister chromatid cohesion protein PDS5 homolog A [Source:UniProtKB/Swiss-Prot;Acc:A1L1F4]
Human Orthologue:
PDS5A
Human Description:
PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:29088]
Mouse Orthologue:
Pds5a
Mouse Description:
PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14643 Essential Splice Site Available for shipment Available now
sa19496 Nonsense Available for shipment Available now
sa39608 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32667 Nonsense Available for shipment Available now
sa6583 Nonsense Mutation detected in F1 DNA During 2017
sa15921 Nonsense Available for shipment Available now
sa38264 Nonsense Mutation detected in F1 DNA During 2017
sa16957 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14643
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033078   None 432 None 13
ENSDART00000102654   None 1320 None 33
ENSDART00000126785   None 1321 None 33
ENSDART00000143014 Essential Splice Site None 99 1 3

The following transcripts of ENSDARG00000055022 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 22144349)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22679516
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGGTGGTTGCTGTTTGCCTCGCTGAGTGAACTTATACAGAGAAAACAA[G/A]TAAACAATTCCGATTTCTTACCGTCTAAAGTTAGGTTAAGAGTCGAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19496
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033078 Nonsense 129 432 4 13
ENSDART00000102654 Nonsense 129 1320 4 33
ENSDART00000126785 Nonsense 130 1321 4 33
ENSDART00000143014   None 99 None 3

The following transcripts of ENSDARG00000055022 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 22117576)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22652743
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTTTCATCACACGACAATTGAAGGGTCTAGAGGACACCAAGAGCCCA[C/T]AGTTCAACAGATATTTTTACTTGCTAGAGGTGAGATGGCTCTGTTAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39608
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033078 Essential Splice Site 213 432 6 13
ENSDART00000102654 Essential Splice Site 213 1320 6 33
ENSDART00000126785 Essential Splice Site 214 1321 6 33
ENSDART00000143014   None 99 None 3

The following transcripts of ENSDARG00000055022 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 22117045)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22652212
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAAGAGCTGCTGGACACAATCCTCATCAACCTCATCCCTGCTCACAAA[G/A]TAGGCAAATGACCTATTGTGCTTTATTTTTCATTCCAGTCTCAGATAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32667
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033078 Nonsense 281 432 8 13
ENSDART00000102654 Nonsense 281 1320 8 33
ENSDART00000126785 Nonsense 282 1321 8 33
ENSDART00000143014   None 99 None 3

The following transcripts of ENSDARG00000055022 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 22116643)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22651810
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGAACTCTTTGCAATTGACCCTCTGCTCCTAGTCTCCGTGATGCCA[C/T]AGCTTGAGTTTAAATTGAAGGTGACCAAATTGACTCACACTTAATTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6583
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033078 Nonsense 295 432 9 13
ENSDART00000102654 Nonsense 295 1320 9 33
ENSDART00000126785 Nonsense 296 1321 9 33
ENSDART00000143014   None 99 None 3

The following transcripts of ENSDARG00000055022 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 22116510)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22651677
KASP Assay ID:
554-4962.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTTTGTTTTGTTTTTGTCTTTGTAGAGTAATGATGGAGAGGAAAGGT[T/A]AGCTGTGGTAAAATTGCTAGCCAAACTCTTTGGCGCAAAAGACTCTGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15921
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033078   None 432 None 13
ENSDART00000102654 Nonsense 767 1320 21 33
ENSDART00000126785 Nonsense 768 1321 21 33
ENSDART00000143014   None 99 None 3

The following transcripts of ENSDARG00000055022 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 22109241)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22644408
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTTTGTTCCAGCCGTTGTCTCGGAGTCTGAATGCAGATGTACCTGAA[C/T]AGYTGATCACTCCACTCGTGTCWCTGGGACACATCTCCATGCTGGCCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38264
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033078   None 432 None 13
ENSDART00000102654 Nonsense 882 1320 24 33
ENSDART00000126785 Nonsense 883 1321 24 33
ENSDART00000143014   None 99 None 3

The following transcripts of ENSDARG00000055022 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 22108575)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22643742
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTAACACACATTTGTTTGTTTGTGTACACAGCAAGTCTGACATGTCT[C/T]GACTAAGGCTTGCAGCCGGGAGTGCCATCCTGAAACTAGCACAAGAGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16957
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033078   None 432 None 13
ENSDART00000102654 Essential Splice Site 1207 1320 31 33
ENSDART00000126785 Essential Splice Site 1208 1321 31 33
ENSDART00000143014   None 99 None 3

The following transcripts of ENSDARG00000055022 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 22104406)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22639573
KASP Assay ID:
2259-0554.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAGAACGAAGAGAATCCTGWGATCACAAAAGCAGTCAGTGTAAAGAAG[G/A]TAYGAAATGAAAAGGTCTKWATGTTCACACTGCTATCATCCTCAACTCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link