col4a1

Ensembl ID:
ENSDARG00000055009
ZFIN ID:
ZDB-GENE-081105-114
Description:
Novel type IV collagen alpha chain protein [Source:UniProtKB/TrEMBL;Acc:B8JK27]
Human Orthologue:
COL4A1
Human Description:
collagen, type IV, alpha 1 [Source:HGNC Symbol;Acc:2202]
Mouse Orthologue:
Col4a1
Mouse Description:
collagen, type IV, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88454]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21437 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16923 Nonsense Available for shipment Available now
sa8330 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21437
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077296 None None 1601 None 50
ENSDART00000130442 Essential Splice Site 26 1644 2 52
Genomic Location:
Chromosome 9 (position 8714870)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCCTCCTAGTGTTTCAAAGCTGACATAATTTTTCATCTTTTTCTTTC[A/T]GGGTGGATGCTCGGGGTCTTCATGTGGTGGTTGTGACTGCAGCGGTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16923
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077296 Nonsense 765 1601 30 50
ENSDART00000130442 Nonsense 803 1644 32 52
Genomic Location:
Chromosome 9 (position 8697648)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCTTGGTAATGTCCCAGGCCAGTCTGGAATAAAGGGTGACAAGGGTTA[T/A]CAAGGACTACCTGGTTTGGACATGCCTGGCCCTCCAGGAGACAGAGGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8330
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077296 Essential Splice Site 1517 1601 48 50
ENSDART00000130442 Essential Splice Site 1560 1644 50 52
Genomic Location:
Chromosome 9 (position 8680803)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTCCCGATGGCTGGGCTTCACTCTGGATTGGATACTCTTTCGTTATGG[T/C]GAGAAAACCAGATAAATTAAAACAAAATCGACTAATTAAATAATGTGAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tn4rvvco