Q1RLV8_DANRE

Ensembl ID:
ENSDARG00000054984
Description:
LOC573743 protein [Source:UniProtKB/TrEMBL;Acc:Q1RLV8]
Human Orthologue:
ZBTB41
Human Description:
zinc finger and BTB domain containing 41 [Source:HGNC Symbol;Acc:24819]
Mouse Orthologue:
Zbtb41
Mouse Description:
zinc finger and BTB domain containing 41 homolog Gene [Source:MGI Symbol;Acc:MGI:2444487]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25102 Essential Splice Site Mutation detected in F1 DNA During 2017
sa9876 Nonsense Available for shipment Available now
sa14303 Essential Splice Site Available for shipment Available now
sa16227 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25102
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089618 Essential Splice Site 357 733 4 10
ENSDART00000108841 Essential Splice Site 457 833 5 11
Genomic Location (Zv9):
Chromosome 2 (position 13597103)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 14081762
KASP Assay ID:
554-7691.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAAGTCACGGTTTGCCAGGCTAAAGCACCAAGAAAAGTTCCATTTAGG[T/A]AAAGTTTTCCTAAAACCATTTTTCTGAATGTGTTGTTTTTCTTGTTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9876
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089618 Nonsense 384 733 5 10
ENSDART00000108841 Nonsense 484 833 6 11
Genomic Location (Zv9):
Chromosome 2 (position 13597324)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 14081983
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTAAWGACACAGGCAACCGCAAACGTCATATAGAGTGCACACATGGG[G/T]GAAAGAGGAAATGGACCTGTTTTCTGTGCGGCAAATCAGTTCGAGAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14303
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089618 Essential Splice Site 400 733 5 10
ENSDART00000108841 Essential Splice Site 500 833 6 11
Genomic Location (Zv9):
Chromosome 2 (position 13597375)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 14082034
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGAGGAAATGGACCTGTTTTCTGTGCGGCAAATCAGTWCGAGAGAGG[T/A]GAGAGAAGTTGCTTTTATTCTCAATCTTTAGTCATGYTTCCATCCAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16227
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089618 Nonsense 577 733 10 10
ENSDART00000108841 Nonsense 677 833 11 11
Genomic Location (Zv9):
Chromosome 2 (position 13632733)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 14117206
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATGTACGTCCTTTCAACTGCCCACACTGCAGTGCTACCTTCAAGCGT[A/T]AGRACAAGCTCAARTATCACRTTGATCATGTGCACAGTGTTCRTCTGCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link