ebna1bp2l

Ensembl ID:
ENSDARG00000054980
ZFIN ID:
ZDB-GENE-030131-6989
Description:
probable rRNA-processing protein EBP2 [Source:RefSeq peptide;Acc:NP_001003840]
Human Orthologue:
EBNA1BP2
Human Description:
EBNA1 binding protein 2 [Source:HGNC Symbol;Acc:15531]
Mouse Orthologue:
Ebna1bp2
Mouse Description:
EBNA1 binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1916322]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11622 Nonsense Available for shipment Available now
sa19697 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11622
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077259 Nonsense 36 308 2 9
Genomic Location:
Chromosome 2 (position 13527316)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTAATGCTCTCTGTTCAGCTGCAAGAAGCTTTCGCTAAGGGWTTGCTC[A/T]AACCTGGATTGAATATCCCTCAGGATGAGCAAAAGAAGACCATCAACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19697
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077259 Essential Splice Site 184 308 6 9
Genomic Location:
Chromosome 2 (position 13543030)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCAAATATTAAATTCATTAAATCATGTATTTAAATATGCGGCTCTACA[G/A]GTTCAAACTGAGGTGATTCAGAACAGGCAAAAACAAAAGAAAGCAATGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1mwcgf16