si:ch211-160j6.2

Ensembl ID:
ENSDARG00000054978
ZFIN ID:
ZDB-GENE-030131-3724
Description:
Novel kinesin motor domain containing protein [Source:UniProtKB/TrEMBL;Acc:Q1LXY1]
Human Orthologue:
KIFC3
Human Description:
kinesin family member C3 [Source:HGNC Symbol;Acc:6326]
Mouse Orthologue:
Kifc3
Mouse Description:
kinesin family member C3 Gene [Source:MGI Symbol;Acc:MGI:109202]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa644 Essential Splice Site F2 line generated During 2017
sa29094 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa644
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077251   None 937 None 20
ENSDART00000132184   None 690 None 13
ENSDART00000138075 Essential Splice Site None 88 2 4
ENSDART00000138511 Essential Splice Site None 115 2 4
ENSDART00000140357 Essential Splice Site 102 140 2 2
ENSDART00000145288   None 753 None 16

The following transcripts of ENSDARG00000054978 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 43975659)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 45564714
KASP Assay ID:
554-0553.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGRCACCGATGTTGATATATCTTGTATGTTTCTGCTCTGTGTGTGCGCA[G/A]CCCGTCCAGCGGTGTGGTCTGCTCGGCCCTGCGGTCATGTACGGCACACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077251 Essential Splice Site 347 937 7 20
ENSDART00000132184 Essential Splice Site 134 690 2 13
ENSDART00000138075   None 88 None 4
ENSDART00000138511   None 115 None 4
ENSDART00000140357   None 140 None 2
ENSDART00000145288 Essential Splice Site 134 753 2 16

The following transcripts of ENSDARG00000054978 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 43988300)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 45577355
KASP Assay ID:
2261-2591.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGACGACGAGGACACACTGCGTCGACACACTACAGTGCCACAGGTCAAG[G/A]TGACATAATAATGATATTGATAGTCATTTCAAAGCCTGTGCATTATAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link