si:ch211-175f11.2

Ensembl ID:
ENSDARG00000054973
ZFIN ID:
ZDB-GENE-050309-102
Description:
intersectin-like [Source:RefSeq peptide;Acc:NP_001003547]
Human Orthologue:
ITSN2
Human Description:
intersectin 2 [Source:HGNC Symbol;Acc:6184]
Mouse Orthologue:
Itsn2
Mouse Description:
intersectin 2 Gene [Source:MGI Symbol;Acc:MGI:1338049]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36447 Essential Splice Site Mutation detected in F1 DNA During 2017
sa25044 Nonsense Mutation detected in F1 DNA During 2017
sa23112 Nonsense Available for shipment Available now
sa42958 Nonsense Mutation detected in F1 DNA During 2017
sa32159 Essential Splice Site Available for shipment Available now
sa18555 Nonsense Available for shipment Available now
sa23111 Nonsense Available for shipment Available now
sa11862 Nonsense Available for shipment Available now
sa32158 Nonsense Available for shipment Available now
sa32157 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36447
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087111 Essential Splice Site 259 1741 8 37
Genomic Location (Zv9):
Chromosome 17 (position 30562241)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30486168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCAACAGTTTAACAGCCTGGACAAACTAATGAGCGGTTATCTAACAG[G/T]TACTTCAATGTAAATGATTTCCAAGTAAATAGTTTAAGAAATGTTTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25044
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087111 Nonsense 413 1741 12 37
Genomic Location (Zv9):
Chromosome 17 (position 30559303)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30483230
KASP Assay ID:
554-7567.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGAGCACAGAAGGCCAGAGAGGAGCAGGAGCGGAGAGAAAGAGAAGCA[C/T]GAGAGCTGGAGCTGAAGAGGAAGAGGGAAGAAGAGATCCGACTGGAGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23112
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087111 Nonsense 647 1741 17 37
Genomic Location (Zv9):
Chromosome 17 (position 30553182)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30477109
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAAGAGTCTGCTTTGGAAAAACTGCGCACCATCAAGGAAGAAAAAATA[C/T]GAGAGCTTAAGAAGCGAAAGCAGGAAGAACTTGAAAAGAAAAGAAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42958
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087111 Nonsense 744 1741 18 37
Genomic Location (Zv9):
Chromosome 17 (position 30552810)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30476737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAGAAGAGGAGAGGAGGCGTAGGGAGGAGGAGGAAGAACGGAGAGAA[C/T]AAGAGAGACGCAGACTGGAGGAGGAGGACCGCAGGCGGAGAGATGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32159
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087111 Essential Splice Site 1015 1741 20 37
Genomic Location (Zv9):
Chromosome 17 (position 30551138)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30475065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGTCGTGGCTAAACAAGCCCTAAAACCCCAGGTCTCCATCTCTGTCAG[G/A]TGTGGTCCCCATTCTAAATTTATCATCCTCTCGAAATGCATCATTTACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18555
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087111 Nonsense 1037 1741 22 37
Genomic Location (Zv9):
Chromosome 17 (position 30546189)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30470116
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATGTTATAYATTTATCWCATCCTCAGAATAYGTSGCTCTTTACACTTA[T/A]GAGAGTCCTGAGCCTGGAGACCTGACCTTCAATGAGGGYGAMACTATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23111
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087111 Nonsense 1194 1741 26 37
Genomic Location (Zv9):
Chromosome 17 (position 30543387)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30467314
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCGCTATTTACGACTACACCGCAGCGAACGAGGACGAGCTGAGCTTCT[C/A]GAAGAGTCAAGTCATCAACGTTCTGGACAAAAGCAATCCTGACTGGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11862
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087111 Nonsense 1311 1741 28 37
Genomic Location (Zv9):
Chromosome 17 (position 30538708)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30462635
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARATGAACATGATAYTTGCCAACTGGAGAGAGCTTATTCAGTGCAGCTCC[A/T]AGATGCTYAAGTATGTGTGGTTCATTTGAAAATGTATATACTGTACWTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32158
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087111 Nonsense 1344 1741 29 37
Genomic Location (Zv9):
Chromosome 17 (position 30538519)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30462446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAGTTCACATGATTGGCGATATCCTGACATCCGAGCTGTCAAACATG[C/T]AGGCCTACATCCGCTTCTGCAGCTGCCAGTTGGAGGGTGCTGCGCTGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32157
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087111 Essential Splice Site 1689 1741 36 37
Genomic Location (Zv9):
Chromosome 17 (position 30534418)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30458345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGTCCTCTGCATTACGATTAACGAGAAAGAGCTGTTTTCACCAGATG[G/A]TTAGTATGAAATAACATGTATGATACTATTTCTAAACCAGACCGAAACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Working memory: Genome-wide pharmacogenomic study of neurocognition as an indicator of antipsychotic treatment response in schizophrenia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link