mc5rb

Ensembl ID:
ENSDARG00000054946
ZFIN ID:
ZDB-GENE-021223-4
Description:
melanocortin 5b receptor [Source:RefSeq peptide;Acc:NP_775387]
Human Orthologue:
MC5R
Human Description:
melanocortin 5 receptor [Source:HGNC Symbol;Acc:6933]
Mouse Orthologue:
Mc5r
Mouse Description:
melanocortin 5 receptor Gene [Source:MGI Symbol;Acc:MGI:99420]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14442 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14442
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077226 Nonsense 78 328 1 1
ENSDART00000124496 Nonsense 89 336 3 3
Genomic Location:
Chromosome 16 (position 32887423)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCATTGTAAAGAACAAGAACCTCCACTCACCAATGTACTTSTTTGTATG[C/A]AGCCTAGCAGTGGCCGACATGTTAGTGAGCGTCTCTAATGCTTGGGAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0zzfaxeo