si:dkey-199k9.3

Ensembl ID:
ENSDARG00000054941
ZFIN ID:
ZDB-GENE-091230-3
Human Orthologue:
C18orf1
Human Description:
chromosome 18 open reading frame 1 [Source:HGNC Symbol;Acc:1224]
Mouse Orthologue:
D18Ertd653e
Mouse Description:
DNA segment, Chr 18, ERATO Doi 653, expressed Gene [Source:MGI Symbol;Acc:MGI:1277150]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19145 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19145
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077222 Nonsense 39 310 2 5
ENSDART00000146508   None 265 None 4
Genomic Location (Zv9):
Chromosome 16 (position 32990956)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30729471
KASP Assay ID:
2260-9860.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGATGTCTAAATGTGGGCTCACAGGTCTGTGATCAGCTCAACCACTGC[G/T]GAGACAACAGTGATGAGGAGCACTGCCCCATCTCCACTCAGCATCCTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link