LOC562282

Ensembl ID:
ENSDARG00000054931
Human Orthologue:
PPP2R5B
Human Description:
protein phosphatase 2, regulatory subunit B', beta [Source:HGNC Symbol;Acc:9310]
Mouse Orthologue:
Ppp2r5b
Mouse Description:
protein phosphatase 2, regulatory subunit B (B56), beta isoform Gene [Source:MGI Symbol;Acc:MGI:2388

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8835 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8835
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077215 Nonsense 256 495 6 14
Genomic Location:
Chromosome 7 (position 26244273)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTATGAAACTGAGCGTTTCAATGGAGTTGCGGAACTWCTGGAAATTT[T/A]GGGAAGGTAGATATTCTTATATACTTTTGGTCTGTCATAACAGAAAGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b5cz6e2v