dgat1b

Ensembl ID:
ENSDARG00000054914
ZFIN ID:
ZDB-GENE-040718-158
Description:
diacylglycerol O-acyltransferase homolog 1b [Source:RefSeq peptide;Acc:NP_001002458]
Human Orthologue:
DGAT1
Human Description:
diacylglycerol O-acyltransferase 1 [Source:HGNC Symbol;Acc:2843]
Mouse Orthologue:
Dgat1
Mouse Description:
diacylglycerol O-acyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1333825]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42756 Essential Splice Site Mutation detected in F1 DNA During 2017
sa2838 Nonsense F2 line generated During 2017
sa39109 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42756
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077185 Essential Splice Site 343 507 12 17
ENSDART00000147890   None 78 None 3
Genomic Location (Zv9):
Chromosome 16 (position 33284235)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31022750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGAAATGGACTACACTAGAATGACAGAGCGGCTGCTTAGGCTGGCAG[T/A]AAGTAAAACAAACTTTAGGGTCAATGCATTCTCCTCAGAATAGAAAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2838
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077185 Nonsense 412 507 15 17
ENSDART00000147890   None 78 None 3
Genomic Location (Zv9):
Chromosome 16 (position 33282146)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31020661
KASP Assay ID:
554-2578.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCTTCTCTCTCCTGTTTTCAAAGGCACTTTTACAAGCCGCTGCTGAGA[C/T]GAGGTGCCGGCAAGTTACTGAGCCAATCAGCTGTGTTTTTCGCCTCTGCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa39109
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077185 Nonsense 432 507 15 17
ENSDART00000147890   None 78 None 3
Genomic Location (Zv9):
Chromosome 16 (position 33282086)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31020601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGTTACTGAGCCAATCAGCTGTGTTTTTCGCCTCTGCTTTTTTTCAT[G/T]AGGTGAGATGTGCATAAATCACACGTTGTTTTAAATATTCTGTCAGGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link