mta3

Ensembl ID:
ENSDARG00000054903
ZFIN ID:
ZDB-GENE-030131-6485
Description:
metastasis-associated protein MTA3 [Source:RefSeq peptide;Acc:NP_956206]
Human Orthologue:
MTA3
Human Description:
metastasis associated 1 family, member 3 [Source:HGNC Symbol;Acc:23784]
Mouse Orthologue:
Mta3
Mouse Description:
metastasis associated 3 Gene [Source:MGI Symbol;Acc:MGI:2151172]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31877 Essential Splice Site Mutation detected in F1 DNA During 2016
sa13464 Nonsense Available for shipment Available now
sa9628 Nonsense Available for shipment Available now
sa35301 Nonsense Mutation detected in F1 DNA During 2016
sa22102 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa31877
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077180 Essential Splice Site 9 517 2 15
ENSDART00000122665 Essential Splice Site 9 709 1 19
ENSDART00000127454 Essential Splice Site 9 517 1 14

The following transcripts of ENSDARG00000054903 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 26751798)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 25132786
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAACACTCCGGGAGGGCAGAAATGGCGGCCAACATGTACCGGGTCGGAG[G/A]TATGTCCGTCTATATTCTGAATTAACGCAAGTCAAAACACAGGCACCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13464
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077180 Nonsense 246 517 10 15
ENSDART00000122665 Nonsense 246 709 9 19
ENSDART00000127454 Nonsense 246 517 9 14

The following transcripts of ENSDARG00000054903 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 26782549)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 25163537
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WCTGGCTTTCTGAAGTTTCAMGCTATGGACACACTGCATCGGCAYGGCTA[T/A]GACCTGTCCAGTGCTCTCAGCGTTCTTGTTCCTCAAGGTGGGCCAGTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9628
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077180 Nonsense 515 517 15 15
ENSDART00000122665   None 709 None 19
ENSDART00000127454 Nonsense 515 517 14 14

The following transcripts of ENSDARG00000054903 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 26794560)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 25175548
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGTGCCCATTAACTGTGGTGCCATAAAGGCGGAGTGTAAGAGCTCTT[T/A]AAATTCCTAACTTCAGCGTCGCGTACAAACACACACACATCCCACATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35301
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077180   None 517 None 15
ENSDART00000122665 Nonsense 582 709 16 19
ENSDART00000127454   None 517 None 14

The following transcripts of ENSDARG00000054903 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 26799290)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 25180278
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGCTTTCCTCTCTTCCAAGTCATGGCCCGCTTGGAATGTTGGGAAAA[C/T]GAAGCTACCATCACCACAGCAGGGTTGAATCTGCAGAAAGGAGGGCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22102
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077180   None 517 None 15
ENSDART00000122665 Essential Splice Site 602 709 16 19
ENSDART00000127454   None 517 None 14

The following transcripts of ENSDARG00000054903 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 26799354)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 25180342
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACAGCAGGGTTGAATCTGCAGAAAGGAGGGCTGGTGCTACAGGACAAG[G/A]TGGGTTTACTGTTAAAATGGAAACTAAAATGGAAAGAAAATGTGTAGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link