mta3

Ensembl ID:
ENSDARG00000054903
ZFIN ID:
ZDB-GENE-030131-6485
Description:
metastasis-associated protein MTA3 [Source:RefSeq peptide;Acc:NP_956206]
Human Orthologue:
MTA3
Human Description:
metastasis associated 1 family, member 3 [Source:HGNC Symbol;Acc:23784]
Mouse Orthologue:
Mta3
Mouse Description:
metastasis associated 3 Gene [Source:MGI Symbol;Acc:MGI:2151172]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13464 Nonsense Available for shipment Available now
sa9628 Nonsense Available for shipment Available now
sa22102 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13464
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077180 Nonsense 246 517 10 15
ENSDART00000122665 Nonsense 246 709 9 19
ENSDART00000127454 Nonsense 246 517 9 14

The following transcripts of ENSDARG00000054903 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 26782549)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WCTGGCTTTCTGAAGTTTCAMGCTATGGACACACTGCATCGGCAYGGCTA[T/A]GACCTGTCCAGTGCTCTCAGCGTTCTTGTTCCTCAAGGTGGGCCAGTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9628
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077180 Nonsense 515 517 15 15
ENSDART00000122665 None None 709 None 19
ENSDART00000127454 Nonsense 515 517 14 14

The following transcripts of ENSDARG00000054903 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 26794560)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGTGCCCATTAACTGTGGTGCCATAAAGGCGGAGTGTAAGAGCTCTT[T/A]AAATTCCTAACTTCAGCGTCGCGTACAAACACACACACATCCCACATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22102
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077180 None None 517 None 15
ENSDART00000122665 Essential Splice Site 602 709 16 19
ENSDART00000127454 None None 517 None 14

The following transcripts of ENSDARG00000054903 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 26799354)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACAGCAGGGTTGAATCTGCAGAAAGGAGGGCTGGTGCTACAGGACAAG[G/A]TGGGTTTACTGTTAAAATGGAAACTAAAATGGAAAGAAAATGTGTAGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1dz8m30b