si:ch73-132m10.4

Ensembl ID:
ENSDARG00000054898
ZFIN IDs:
ZDB-GENE-070424-27, ZDB-GENE-081104-29
Description:
membrane-spanning 4-domains, subfamily A, member 17A.17 [Source:RefSeq peptide;Acc:NP_001082925]
Human Orthologues:
MS4A12, MS4A15, MS4A2, MS4A3, MS4A4A, MS4A8B, RP11-312N17.2
Human Descriptions:
Membrane-spanning 4-domains subfamily A member 18 [Source:UniProtKB/Swiss-Prot;Acc:Q3C1V0]
membrane-spanning 4-domains, subfamily A, member 12 [Source:HGNC Symbol;Acc:13370]
membrane-spanning 4-domains, subfamily A, member 15 [Source:HGNC Symbol;Acc:28573]
membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor fo
membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) [Source:HGNC Symbol
membrane-spanning 4-domains, subfamily A, member 4 [Source:HGNC Symbol;Acc:13371]
membrane-spanning 4-domains, subfamily A, member 8B [Source:HGNC Symbol;Acc:13380]
Mouse Orthologues:
AC134839.1, Ms4a15, Ms4a2, Ms4a3, Ms4a4b, Ms4a4c, Ms4a4d, Ms4a8a
Mouse Descriptions:
membrane-spanning 4-domains, subfamily A, member 15 Gene [Source:MGI Symbol;Acc:MGI:3617853]
membrane-spanning 4-domains, subfamily A, member 2 Gene [Source:MGI Symbol;Acc:MGI:95495]
membrane-spanning 4-domains, subfamily A, member 3 Gene [Source:MGI Symbol;Acc:MGI:2158468]
membrane-spanning 4-domains, subfamily A, member 4B Gene [Source:MGI Symbol;Acc:MGI:1913083]
membrane-spanning 4-domains, subfamily A, member 4C Gene [Source:MGI Symbol;Acc:MGI:1927656]
membrane-spanning 4-domains, subfamily A, member 4D Gene [Source:MGI Symbol;Acc:MGI:1913857]
membrane-spanning 4-domains, subfamily A, member 8A Gene [Source:MGI Symbol;Acc:MGI:1927657]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40337 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44595 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6954 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40337
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099912 Essential Splice Site 98 293 3 8
ENSDART00000145536 Essential Splice Site 98 169 3 5
Genomic Location (Zv9):
Chromosome 4 (position 60394563)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 74914132
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCTCCATCTTCGTCTTCAGTGGCGCTCCTTACTGGGGATCTGTCCTCG[T/C]AAGAAACAATCCCACAGCAGCGTTTTGCCATGGATAACACAAGCTACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44595
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099912 Essential Splice Site 121 293 4 8
ENSDART00000145536 Essential Splice Site 121 169 4 5
Genomic Location (Zv9):
Chromosome 4 (position 60391086)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCCATTGATGCTGAAAACAAACGTAATTCACCAACCAATTTATGTTTG[G/A]TATGTACACAACACTTGTTCTTTTCATGGGTCTAAGCACTGGGCGCTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6954
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099912 Nonsense 161 293 5 8
ENSDART00000145536 Nonsense 161 169 5 5
Genomic Location (Zv9):
Chromosome 4 (position 60388957)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 74919738
KASP Assay ID:
554-4686.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGATATGCTTACTGGACAATTCWACRRTTACTGCAGTGACTATYATTG[T/A]GCAGAAATGGAGTTGAAGTATACGGTATGTTATTTACACAATTACAGTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link