si:ch73-132m10.4

Ensembl ID:
ENSDARG00000054898
ZFIN IDs:
ZDB-GENE-070424-27, ZDB-GENE-081104-29
Description:
membrane-spanning 4-domains, subfamily A, member 17A.17 [Source:RefSeq peptide;Acc:NP_001082925]
Human Orthologues:
MS4A12, MS4A15, MS4A2, MS4A3, MS4A4A, MS4A8B, RP11-312N17.2
Human Descriptions:
Membrane-spanning 4-domains subfamily A member 18 [Source:UniProtKB/Swiss-Prot;Acc:Q3C1V0]
membrane-spanning 4-domains, subfamily A, member 12 [Source:HGNC Symbol;Acc:13370]
membrane-spanning 4-domains, subfamily A, member 15 [Source:HGNC Symbol;Acc:28573]
membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor fo
membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) [Source:HGNC Symbol
membrane-spanning 4-domains, subfamily A, member 4 [Source:HGNC Symbol;Acc:13371]
membrane-spanning 4-domains, subfamily A, member 8B [Source:HGNC Symbol;Acc:13380]
Mouse Orthologues:
AC134839.1, Ms4a15, Ms4a2, Ms4a3, Ms4a4b, Ms4a4c, Ms4a4d, Ms4a8a
Mouse Descriptions:
membrane-spanning 4-domains, subfamily A, member 15 Gene [Source:MGI Symbol;Acc:MGI:3617853]
membrane-spanning 4-domains, subfamily A, member 2 Gene [Source:MGI Symbol;Acc:MGI:95495]
membrane-spanning 4-domains, subfamily A, member 3 Gene [Source:MGI Symbol;Acc:MGI:2158468]
membrane-spanning 4-domains, subfamily A, member 4B Gene [Source:MGI Symbol;Acc:MGI:1913083]
membrane-spanning 4-domains, subfamily A, member 4C Gene [Source:MGI Symbol;Acc:MGI:1927656]
membrane-spanning 4-domains, subfamily A, member 4D Gene [Source:MGI Symbol;Acc:MGI:1913857]
membrane-spanning 4-domains, subfamily A, member 8A Gene [Source:MGI Symbol;Acc:MGI:1927657]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40337 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6954 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40337
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099912 Essential Splice Site 98 293 3 8
ENSDART00000145536 Essential Splice Site 98 169 3 5
Genomic Location (Zv9):
Chromosome 4 (position 60394563)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 74914132
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCTCCATCTTCGTCTTCAGTGGCGCTCCTTACTGGGGATCTGTCCTCG[T/C]AAGAAACAATCCCACAGCAGCGTTTTGCCATGGATAACACAAGCTACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6954
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099912 Nonsense 161 293 5 8
ENSDART00000145536 Nonsense 161 169 5 5
Genomic Location (Zv9):
Chromosome 4 (position 60388957)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 74919738
KASP Assay ID:
554-4686.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGATATGCTTACTGGACAATTCWACRRTTACTGCAGTGACTATYATTG[T/A]GCAGAAATGGAGTTGAAGTATACGGTATGTTATTTACACAATTACAGTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link