bcas3

Ensembl ID:
ENSDARG00000054893
ZFIN ID:
ZDB-GENE-040426-1257
Description:
breast carcinoma amplified sequence 3 [Source:RefSeq peptide;Acc:NP_956916]
Human Orthologue:
BCAS3
Human Description:
breast carcinoma amplified sequence 3 [Source:HGNC Symbol;Acc:14347]
Mouse Orthologue:
Bcas3
Mouse Description:
breast carcinoma amplified sequence 3 Gene [Source:MGI Symbol;Acc:MGI:2385848]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa423 Essential Splice Site Available for shipment Available now
sa4611 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa423
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077172 Essential Splice Site 328 805 12 21
Genomic Location:
Chromosome 15 (position 26334065)
KASP Assay ID:
554-0370.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTATGTGGCTTCGTCAACTTACTGTAGCTTTATTGTGTGTATGTTTC[A/T]GGTTCTTGTTAGTGAGGATTCTGATGGCGAAGGACTGATTGCACATTTTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa4611
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077172 Nonsense 530 805 15 21
Genomic Location:
Chromosome 15 (position 26387233)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTTCGTTACCCAGTTTGACGGTTGTGCTACCACTGGCTCAGATCAAA[C/T]AACCCATGACCTTGGGCACCATCACMAAGCGCACAGGGTGAGTTTCTACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bwb0tr3r