bcas3

Ensembl ID:
ENSDARG00000054893
ZFIN ID:
ZDB-GENE-040426-1257
Description:
breast carcinoma amplified sequence 3 [Source:RefSeq peptide;Acc:NP_956916]
Human Orthologue:
BCAS3
Human Description:
breast carcinoma amplified sequence 3 [Source:HGNC Symbol;Acc:14347]
Mouse Orthologue:
Bcas3
Mouse Description:
breast carcinoma amplified sequence 3 Gene [Source:MGI Symbol;Acc:MGI:2385848]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa423 Essential Splice Site Available for shipment Available now
sa4611 Nonsense Mutation detected in F1 DNA During 2016
sa35899 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa423
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077172 Essential Splice Site 328 805 12 21
Genomic Location:
Chromosome 15 (position 26334065)
KASP Assay ID:
554-0370.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTATGTGGCTTCGTCAACTTACTGTAGCTTTATTGTGTGTATGTTTC[A/T]GGTTCTTGTTAGTGAGGATTCTGATGGCGAAGGACTGATTGCACATTTTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa4611
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077172 Nonsense 530 805 15 21
Genomic Location:
Chromosome 15 (position 26387233)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTTCGTTACCCAGTTTGACGGTTGTGCTACCACTGGCTCAGATCAAA[C/T]AACCCATGACCTTGGGCACCATCACMAAGCGCACAGGGTGAGTTTCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35899
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077172 Essential Splice Site 706 805 19 21
Genomic Location:
Chromosome 15 (position 26419093)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGCCTCTGATCACAGTGGTCAGGAGGATGAAGAATGGCTCTCACAGG[T/C]GAGTTAGAACCGTGATCTACTCCTCTGGCCTATATCTCTGAATTTTCTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link