NP_001007779.1

Ensembl ID:
ENSDARG00000054874
Description:
G-protein-signaling modulator 1 [Source:RefSeq peptide;Acc:NP_001007779]
Human Orthologue:
GPSM1
Human Description:
G-protein signaling modulator 1 [Source:HGNC Symbol;Acc:17858]
Mouse Orthologue:
Gpsm1
Mouse Description:
G-protein signalling modulator 1 (AGS3-like, C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1915089]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20596 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20596
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011955 Essential Splice Site 139 622 3 17
Genomic Location (Zv9):
Chromosome 5 (position 74860996)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 70974456
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCTGCTGTCAGAGACACCTGGATATTTCTCAAGAGCAGGGAGACAAGG[T/C]GAGAAGAACACTGCTTATCCATGGAGAAATACTGGAGGAGGAGGAGGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link