aplp2

Ensembl ID:
ENSDARG00000054864
ZFIN ID:
ZDB-GENE-061009-28
Description:
amyloid-like protein 2 [Source:RefSeq peptide;Acc:NP_001116484]
Human Orthologue:
APLP2
Human Description:
amyloid beta (A4) precursor-like protein 2 [Source:HGNC Symbol;Acc:598]
Mouse Orthologue:
Aplp2
Mouse Description:
amyloid beta (A4) precursor-like protein 2 Gene [Source:MGI Symbol;Acc:MGI:88047]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29087 Essential Splice Site Mutation detected in F1 DNA During 2015
sa29086 Nonsense Mutation detected in F1 DNA During 2015
sa4051 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa29087
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077125 Essential Splice Site 312 764 6 17
Genomic Location:
Chromosome 18 (position 42834763)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCATGCCGGAGAAACAGGACGATGACAAAACTCTGCAGGAAGTAGAAG[G/A]TCAGTCTCACGCTGTTTCCTTCATTTATTGCCTTACTGCCACAGTGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077125 Nonsense 402 764 8 17
Genomic Location:
Chromosome 18 (position 42825501)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCCCAGCAGATGATAAAGAGCACAGCCGCTTCCAGAAAGCCAAGGAG[C/T]AACTCGAGATCAGACACCGCAACCGTATGGAGAGGGTGAGTGCAGTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077125 Nonsense 756 764 17 17
Genomic Location:
Chromosome 18 (position 42784102)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACGTCACCTGAGCAAGATGCAGAACCACGGCTATGAAAACCCCACTTA[C/A]AAATACCTGGAGCAGATGCAGATTTAGCCATCATGCGGCRCWGTGGAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h08c2tqf