aplp2

Ensembl ID:
ENSDARG00000054864
ZFIN ID:
ZDB-GENE-061009-28
Description:
amyloid-like protein 2 [Source:RefSeq peptide;Acc:NP_001116484]
Human Orthologue:
APLP2
Human Description:
amyloid beta (A4) precursor-like protein 2 [Source:HGNC Symbol;Acc:598]
Mouse Orthologue:
Aplp2
Mouse Description:
amyloid beta (A4) precursor-like protein 2 Gene [Source:MGI Symbol;Acc:MGI:88047]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29087 Essential Splice Site Mutation detected in F1 DNA During 2016
sa29086 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa29087
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077125 Essential Splice Site 312 764 6 17
Genomic Location (Zv9):
Chromosome 18 (position 42834763)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44424654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCATGCCGGAGAAACAGGACGATGACAAAACTCTGCAGGAAGTAGAAG[G/A]TCAGTCTCACGCTGTTTCCTTCATTTATTGCCTTACTGCCACAGTGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077125 Nonsense 402 764 8 17
Genomic Location (Zv9):
Chromosome 18 (position 42825501)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44415392
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCCCAGCAGATGATAAAGAGCACAGCCGCTTCCAGAAAGCCAAGGAG[C/T]AACTCGAGATCAGACACCGCAACCGTATGGAGAGGGTGAGTGCAGTGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link