bcat2

Ensembl ID:
ENSDARG00000054849
ZFIN ID:
ZDB-GENE-040718-425
Description:
branched-chain-amino-acid aminotransferase, mitochondrial [Source:RefSeq peptide;Acc:NP_001002676]
Human Orthologue:
BCAT2
Human Description:
branched chain amino-acid transaminase 2, mitochondrial [Source:HGNC Symbol;Acc:977]
Mouse Orthologue:
Bcat2
Mouse Description:
branched chain aminotransferase 2, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:1276534]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33190 Nonsense Mutation detected in F1 DNA During 2016
sa20027 Nonsense Available for shipment Available now
sa33189 Nonsense Mutation detected in F1 DNA During 2016
sa16687 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077119 Nonsense 32 414 3 11
ENSDART00000136819 Nonsense 24 406 2 10
ENSDART00000139310   None 391 None 11
Genomic Location (Zv9):
Chromosome 3 (position 30111204)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29829243
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAATAAACAGCTCTCCACGTGCCCCGCTGTACTCCCCACCCCTCTCTG[T/A]CTTTTCGTTTTCTCTCCCTTTTTTTGTCTCTTTCTCTCTCTCTGTCTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20027
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077119 Nonsense 210 414 6 11
ENSDART00000136819 Nonsense 202 406 5 10
ENSDART00000139310 Nonsense 187 391 6 11
Genomic Location (Zv9):
Chromosome 3 (position 30109111)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29827150
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTTCTTGTTTCAGCCTTCACTAGGTGTTTCTCGAGCTGGTCACGCGT[T/A]GCTGTTTGTCATCGTTGGACCCGTTGGACCTTATTTTGCCACTGGAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33189
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077119 Nonsense 255 414 7 11
ENSDART00000136819 Nonsense 247 406 6 10
ENSDART00000139310 Nonsense 232 391 7 11
Genomic Location (Zv9):
Chromosome 3 (position 30107201)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29825240
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTGCGGGTCTAAATGCTGCAATTGTGGCTTCTGTTTGTCAGCAACTA[T/A]GGGCCGACCATCGCTGTCCAGAATGAGGCGGCAAAGCAAGGCTGTCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16687
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077119 Essential Splice Site 301 414 8 11
ENSDART00000136819 Essential Splice Site 293 406 7 10
ENSDART00000139310 Essential Splice Site 278 391 8 11
Genomic Location (Zv9):
Chromosome 3 (position 30104579)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29822618
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGATGCACATAAGTGCATCTCAATTCATGGGCATTGGTGTGTGTTTTC[A/T]GAAAAAGAGCTGGTCACYCCTCCACTTGATGGCGTCATTCTTCCAGGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link