bcat2

Ensembl ID:
ENSDARG00000054849
ZFIN ID:
ZDB-GENE-040718-425
Description:
branched-chain-amino-acid aminotransferase, mitochondrial [Source:RefSeq peptide;Acc:NP_001002676]
Human Orthologue:
BCAT2
Human Description:
branched chain amino-acid transaminase 2, mitochondrial [Source:HGNC Symbol;Acc:977]
Mouse Orthologue:
Bcat2
Mouse Description:
branched chain aminotransferase 2, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:1276534]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20027 Nonsense Mutation detected in F1 DNA During 2014
sa16687 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20027
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077119 Nonsense 210 414 6 11
ENSDART00000136819 Nonsense 202 406 5 10
ENSDART00000139310 Nonsense 187 391 6 11
Genomic Location:
Chromosome 3 (position 30109111)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTTCTTGTTTCAGCCTTCACTAGGTGTTTCTCGAGCTGGTCACGCGT[T/A]GCTGTTTGTCATCGTTGGACCCGTTGGACCTTATTTTGCCACTGGAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16687
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077119 Essential Splice Site 301 414 8 11
ENSDART00000136819 Essential Splice Site 293 406 7 10
ENSDART00000139310 Essential Splice Site 278 391 8 11
Genomic Location:
Chromosome 3 (position 30104579)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGATGCACATAAGTGCATCTCAATTCATGGGCATTGGTGTGTGTTTTC[A/T]GAAAAAGAGCTGGTCACYCCTCCACTTGATGGCGTCATTCTTCCAGGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t160dkgm