LOC793479

Ensembl ID:
ENSDARG00000054846
Human Orthologue:
XCR1
Human Description:
chemokine (C motif) receptor 1 [Source:HGNC Symbol;Acc:1625]
Mouse Orthologue:
Xcr1
Mouse Description:
chemokine (C motif) receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1346338]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37777 Nonsense Mutation detected in F1 DNA During 2017
sa29993 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37777
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077122 Nonsense 104 300 1 1
Genomic Location (Zv9):
Chromosome 23 (position 40248333)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 40059186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTACTTCATCCATGGTTGGACGTTTGGAGAGATTGGCTGTAAAGCGGTC[A/T]AGTTTCTGTTCTACGTGGGCTTTTACAGCAGCGTGATGTTCTTGACTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29993
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077122 Nonsense 118 300 1 1
Genomic Location (Zv9):
Chromosome 23 (position 40248290)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 40059143
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGGTCAAGTTTCTGTTCTACGTGGGCTTTTACAGCAGCGTGATGTTCT[T/A]GACTCTCATGACCATTCAGCGCTACATGGCAGTGGTTCATCCTTTGTCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link