si:ch211-257b22.1

Ensembl ID:
ENSDARG00000054844
ZFIN ID:
ZDB-GENE-090313-100
Description:
LOC563520 protein [Source:UniProtKB/TrEMBL;Acc:A2RV39]
Human Orthologue:
MAP7
Human Description:
microtubule-associated protein 7 [Source:HGNC Symbol;Acc:6869]
Mouse Orthologue:
Mtap7
Mouse Description:
microtubule-associated protein 7 Gene [Source:MGI Symbol;Acc:MGI:1328328]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37776 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37776
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077107   None 760 None 19
ENSDART00000109226   None 756 None 19
ENSDART00000110463   None 492 None 13
ENSDART00000136536 Nonsense 128 181 4 5
ENSDART00000142901 Nonsense 118 157 4 5
Genomic Location (Zv9):
Chromosome 23 (position 40040792)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 40008597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGCAGCGGATGAAGGAGGACAAGAGACGTGCTGCTGTGGAGGAAAAA[C/T]GACGGCAGAAGCTGGAGGAGGAGAAGGTCAAAAAATACTTAAAGATACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link