hsd17b14

Ensembl ID:
ENSDARG00000054842
ZFIN ID:
ZDB-GENE-040801-24
Description:
17-beta-hydroxysteroid dehydrogenase 14 [Source:RefSeq peptide;Acc:NP_001003521]
Human Orthologue:
HSD17B14
Human Description:
hydroxysteroid (17-beta) dehydrogenase 14 [Source:HGNC Symbol;Acc:23238]
Mouse Orthologue:
Hsd17b14
Mouse Description:
hydroxysteroid (17-beta) dehydrogenase 14 Gene [Source:MGI Symbol;Acc:MGI:1913315]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26078 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26078
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077111 Nonsense 173 271 7 9

The following transcripts of ENSDARG00000054842 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 30121987)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 29840026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATATTAATACTCTCATAAATCCACAAGGGGGCGATCACCGCCATGACT[A/T]AAGCAATGGCTGTAGATGAGAGCCGCTATCAAGTGAGGGTGAACTGGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link