nucb1

Ensembl ID:
ENSDARG00000054833
ZFIN ID:
ZDB-GENE-060825-222
Description:
nucleobindin-1 [Source:RefSeq peptide;Acc:NP_001038928]
Human Orthologue:
NUCB1
Human Description:
nucleobindin 1 [Source:HGNC Symbol;Acc:8043]
Mouse Orthologue:
Nucb1
Mouse Description:
nucleobindin 1 Gene [Source:MGI Symbol;Acc:MGI:97388]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33192 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20030 Essential Splice Site Available for shipment Available now
sa15054 Nonsense Available for shipment Available now
hu7895 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33192
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077089 Essential Splice Site 38 454 2 13
Genomic Location (Zv9):
Chromosome 3 (position 30303840)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30021879
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCGCAACCCAGACCCTCCTCAGGAGGAGAAAGCAGAGGAGAATGTGG[T/C]AAGACGGCTCTCGCATCATGCTGTCAGAGCTCATCTTGTGCTCTCAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20030
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077089 Essential Splice Site 119 454 4 13
Genomic Location (Zv9):
Chromosome 3 (position 30301981)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30020020
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCTCAGGATGCTGCTGAAGGCTAAACTGGACAGCACCAATGCCCAGAG[T/G]CAGTGTGTTTATGCTTGTGTTGCACTCAGTTGTGCTGATGAATGAGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15054
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077089 Nonsense 350 454 11 13
Genomic Location (Zv9):
Chromosome 3 (position 30294789)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30012828
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGTSTATACAGAAGAGGAGCTGCAGCRCTTTGAGACAGAACTTCGGGAT[A/T]AAGAGCTGGAGCTCGGCAGAAGAGCAGAGAAATTAAGACAGGAGCAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu7895
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077089 Nonsense 380 454 11 13
Genomic Location (Zv9):
Chromosome 3 (position 30294699)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30012738
KASP Assay ID:
554-2391.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGCAGGAACTTCTGAAAGAGAGAAGCAAAGCTCTTGAAGCACAGAAA[C/T]GAGAATATCAGCAGGTAAACRGTGTSAAATGTAACAGAGGTGGTTGCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link