nubpl

Ensembl ID:
ENSDARG00000054821
ZFIN ID:
ZDB-GENE-040718-140
Description:
nucleotide-binding protein-like [Source:RefSeq peptide;Acc:NP_001002442]
Human Orthologue:
NUBPL
Human Description:
nucleotide binding protein-like [Source:HGNC Symbol;Acc:20278]
Mouse Orthologue:
Nubpl
Mouse Description:
nucleotide binding protein-like Gene [Source:MGI Symbol;Acc:MGI:1924076]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36458 Nonsense Mutation detected in F1 DNA During 2017
sa10916 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36458
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077077 Nonsense 178 327 6 11
ENSDART00000129175 Nonsense 181 330 5 10
Genomic Location (Zv9):
Chromosome 17 (position 31781598)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 31705525
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATTGTGTGGAGGGGTCTGATGGTGATGTCAGCTATAGAGAAACTTATT[A/T]GACAGGTGTGTGGTTTAGAATTGGAAATTGCTGTTTGTCAAATACATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10916
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077077 Essential Splice Site 280 327 9 11
ENSDART00000129175 Essential Splice Site 283 330 8 10
Genomic Location (Zv9):
Chromosome 17 (position 31784795)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 31708722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGATGGGGCTAAAGAGTTGGCTCAAACCCTTGGTGTTGAGTTGCTTGG[T/C]AAGGCCATTTTATGATMATTATTACTTTATAACTGATTGTTTGAGCATAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link