rfc1

Ensembl ID:
ENSDARG00000054799
ZFIN ID:
ZDB-GENE-070410-99
Description:
replication factor C subunit 1 [Source:RefSeq peptide;Acc:NP_001082960]
Human Orthologue:
RFC1
Human Description:
replication factor C (activator 1) 1, 145kDa [Source:HGNC Symbol;Acc:9969]
Mouse Orthologue:
Rfc1
Mouse Description:
replication factor C (activator 1) 1 Gene [Source:MGI Symbol;Acc:MGI:97891]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3352 Nonsense Confirmed mutation in F2 line During 2014
sa18695 Nonsense Mutation detected in F1 DNA During 2014
sa19495 Essential Splice Site, Missense Mutation detected in F1 DNA During 2014
sa11513 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3352
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077055 None None 529 None 13
ENSDART00000114600 Nonsense 640 1128 15 26
ENSDART00000121783 None None 529 None 13
ENSDART00000143948 Nonsense 658 1147 13 24
ENSDART00000146575 None None 126 None 5
ENSDART00000077055 None None 529 None 13
ENSDART00000114600 Nonsense 640 1128 15 26
ENSDART00000121783 None None 529 None 13
ENSDART00000143948 Nonsense 658 1147 13 24
ENSDART00000146575 None None 126 None 5

The following transcripts of ENSDARG00000054799 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 22029070)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATCTGGACCCCCTGGTGTTGGGAAGACCACTACTGCTGCTCTCGTTTG[T/A]GAGGTCAGTTCATTCTCACATATAAACAACTTTTACATCTTGTTTGACTA
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Larval:Protruding-mouth
ZFS:0000035
cranium
ZFA:0000737
malformed
PATO:0000646
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
eye
ZFA:0000107
degenerate
PATO:0000639
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
inner ear
ZFA:0000217
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
ventral mandibular arch
ZFA:0001273
absent
PATO:0000462
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa18695
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077055 None None 529 None 13
ENSDART00000114600 Nonsense 640 1128 15 26
ENSDART00000121783 None None 529 None 13
ENSDART00000143948 Nonsense 658 1147 13 24
ENSDART00000146575 None None 126 None 5
ENSDART00000077055 None None 529 None 13
ENSDART00000114600 Nonsense 640 1128 15 26
ENSDART00000121783 None None 529 None 13
ENSDART00000143948 Nonsense 658 1147 13 24
ENSDART00000146575 None None 126 None 5

The following transcripts of ENSDARG00000054799 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 22029070)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATCTGGACCCCCTGGTGTTGGGAAGACCACTACTGCTGCTCTCGTTTG[T/A]GAGGTCAGTTCATTCTCACATATAAACAACTTTTACATCTTGTTTGACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19495
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077055 None None 529 None 13
ENSDART00000114600 Essential Splice Site 1027 1128 24 26
ENSDART00000121783 None None 529 None 13
ENSDART00000143948 Missense 1046 1147 22 24
ENSDART00000146575 None None 126 None 5

The following transcripts of ENSDARG00000054799 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 22022882)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGATGGAGATCAGCACATGGGATGGACAGCCGGATCCGTACTCTAAAC[T/G]AGACTCCAAGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11513
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077055 None None 529 None 13
ENSDART00000114600 Nonsense 1040 1128 25 26
ENSDART00000121783 None None 529 None 13
ENSDART00000143948 Nonsense 1058 1147 23 24
ENSDART00000146575 None None 126 None 5

The following transcripts of ENSDARG00000054799 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 22022606)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTNNNCTTTTCCCCTTTTCGCAGGTGAAAGCTGCGTTTACAAGAGCCTA[C/A]AACAAAGAATCTCATCTCACGCCATACTCCTTACAAGTRGTGAAGAAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2b0esyvv