rfc1

Ensembl ID:
ENSDARG00000054799
ZFIN ID:
ZDB-GENE-070410-99
Description:
replication factor C subunit 1 [Source:RefSeq peptide;Acc:NP_001082960]
Human Orthologue:
RFC1
Human Description:
replication factor C (activator 1) 1, 145kDa [Source:HGNC Symbol;Acc:9969]
Mouse Orthologue:
Rfc1
Mouse Description:
replication factor C (activator 1) 1 Gene [Source:MGI Symbol;Acc:MGI:97891]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38263 Essential Splice Site Mutation detected in F1 DNA During 2016
sa19495 Essential Splice Site, Missense Mutation detected in F1 DNA During 2016
sa11513 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38263
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077055   None 529 None 13
ENSDART00000114600 Essential Splice Site 755 1128 18 26
ENSDART00000121783   None 529 None 13
ENSDART00000143948 Essential Splice Site 773 1147 16 24
ENSDART00000146575   None 126 None 5

The following transcripts of ENSDARG00000054799 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 22027919)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22563086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTATTGCTATGACCTGCGCTTTCAGAGACCCCGCGTTGAGCAGATCAAG[G/A]TGACCGTCAGACAAATTCAGATATTTCGAGAGCATGATTAAATTCATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19495
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077055   None 529 None 13
ENSDART00000114600 Essential Splice Site 1027 1128 24 26
ENSDART00000121783   None 529 None 13
ENSDART00000143948 Missense 1046 1147 22 24
ENSDART00000146575   None 126 None 5

The following transcripts of ENSDARG00000054799 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 22022882)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22558049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGATGGAGATCAGCACATGGGATGGACAGCCGGATCCGTACTCTAAAC[T/G]AGACTCCAAGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11513
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077055   None 529 None 13
ENSDART00000114600 Nonsense 1040 1128 25 26
ENSDART00000121783   None 529 None 13
ENSDART00000143948 Nonsense 1058 1147 23 24
ENSDART00000146575   None 126 None 5

The following transcripts of ENSDARG00000054799 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 22022606)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22557773
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTNNNCTTTTCCCCTTTTCGCAGGTGAAAGCTGCGTTTACAAGAGCCTA[C/A]AACAAAGAATCTCATCTCACGCCATACTCCTTACAAGTRGTGAAGAAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link