plcxd3

Ensembl ID:
ENSDARG00000054794
ZFIN ID:
ZDB-GENE-050327-10
Description:
PI-PLC X domain-containing protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q58EK3]
Human Orthologue:
PLCXD3
Human Description:
phosphatidylinositol-specific phospholipase C, X domain containing 3 [Source:HGNC Symbol;Acc:31822]
Mouse Orthologue:
Plcxd3
Mouse Description:
phosphatidylinositol-specific phospholipase C, X domain containing 3 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12146 Nonsense Available for shipment Available now
sa8998 Nonsense Mutation detected in F1 DNA During 2017
sa905 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12146
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077053 Nonsense 54 322 2 3
Genomic Location (Zv9):
Chromosome 8 (position 32698992)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31841718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGACTCCTTCAGTTTCTACATTGAYGAAGCCTCACCAGTGGGTCCAGAG[C/T]AACCWGAAACAGTGCAGAACTTTGTKTCTGTGTTTGGCACTGTGGCTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8998
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077053 Nonsense 232 322 2 3
Genomic Location (Zv9):
Chromosome 8 (position 32699527)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31842253
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGGCCAAYACCACAGATCCTGAGAAGCTCATTCTGTTCCTTCAAGCTT[C/A]AGTAAAGGATCGGAGACGTAAGGGCACCTTTTTTGTGTCCYAGGTGRTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa905
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077053 Nonsense 246 322 2 3
Genomic Location (Zv9):
Chromosome 8 (position 32699568)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31842294
KASP Assay ID:
554-0812.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAAGCTTCAGTAAAGGATCGGAGACGTAAGGGCACCTTTTTTGTGTCC[C/T]AGGTGGTTCTTACTCCAAAAGCAAGCACCGTCATGAAGGGAGTCACCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link