pogza

Ensembl ID:
ENSDARG00000054778
ZFIN ID:
ZDB-GENE-040914-76
Description:
Novel protein similar to vertebrate pogo transposable element with ZNF domain (POGZ) [Source:UniProt
Human Orthologue:
POGZ
Human Description:
pogo transposable element with ZNF domain [Source:HGNC Symbol;Acc:18801]
Mouse Orthologue:
Pogz
Mouse Description:
pogo transposable element with ZNF domain Gene [Source:MGI Symbol;Acc:MGI:2442117]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15396 Nonsense Available for shipment Available now
sa25096 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15396
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076938 Nonsense 492 1277 11 19
Genomic Location (Zv9):
Chromosome 19 (position 43968214)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42878016
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAACCACATGAAACACRTGCACAAGCCTGGCGAGATGCCCTACGTGTG[T/A]AAGGTAAGTCATGCTTCATTRCATTCCTATTAACAAAAACTGCTTCGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25096
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076938 Essential Splice Site 542 1277 12 19
Genomic Location (Zv9):
Chromosome 19 (position 43968460)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42878262
KASP Assay ID:
554-7518.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATATTTAGGTCTTGTGGCGGATTTCAGTTGCACTACACTAGACATCAG[G/A]TAAACAATGTGCTTGGCATTATCAGTATTATTTAATGCTTGTATATTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link