ghra

Ensembl ID:
ENSDARG00000054771
ZFIN ID:
ZDB-GENE-070509-1
Description:
growth hormone receptor [Source:RefSeq peptide;Acc:NP_001077047]
Human Orthologue:
GHR
Human Description:
growth hormone receptor [Source:HGNC Symbol;Acc:4263]
Mouse Orthologue:
Ghr
Mouse Description:
growth hormone receptor Gene [Source:MGI Symbol;Acc:MGI:95708]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34438 Essential Splice Site Available for shipment Available now
sa34437 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34438
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018886 Essential Splice Site 275 570 8 9
ENSDART00000127194 Essential Splice Site 275 570 7 8
ENSDART00000130074 Essential Splice Site 55 255 8 10
Genomic Location (Zv9):
Chromosome 8 (position 32317042)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31459768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAATTCGGAAGTATGCACTTACATTTATTTTTATATTATTTTTTTCCAC[A/T]GGTTGATGGTAATCTTTTTACCACCTATTCCTGCACCTAAAATTAAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34437
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018886 Nonsense 488 570 9 9
ENSDART00000127194 Nonsense 488 570 8 8
ENSDART00000130074 Nonsense 201 255 10 10
Genomic Location (Zv9):
Chromosome 8 (position 32313827)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31456553
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTCCAGCTGGTTTGCGATGGAGCCTACACTTCAGAGACCACAGCCAGG[C/T]AGTTTTCTGCAGATGTCCCATCTAGTCCTGGTCCGGAACAGGAATACCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link