col10a1

Ensembl ID:
ENSDARG00000054753
ZFIN IDs:
ZDB-GENE-030131-8373, ZDB-GENE-030131-8373
Description:
collagen, type X, alpha 1 [Source:RefSeq peptide;Acc:NP_001077296]
Human Orthologue:
COL10A1
Human Description:
collagen, type X, alpha 1 [Source:HGNC Symbol;Acc:2185]
Mouse Orthologue:
Col10a1
Mouse Description:
collagen, type X, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88445]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23026 Nonsense Mutation detected in F1 DNA During 2014
sa23025 Nonsense Mutation detected in F1 DNA During 2014
sa12685 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23026
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091021 Nonsense 384 655 3 3
ENSDART00000123817 None None 163 None 2
Genomic Location:
Chromosome 17 (position 15384698)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGAGCCCAAGGCATTGAAGGCAAGCAAGGTTATCCAGGGGCAACAGGT[C/T]AGCCAGGTCCAAGGGGAGCAACAGGTGCTCCTGGAGCCAAAGGAGAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23025
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091021 Nonsense 496 655 3 3
ENSDART00000123817 Nonsense 86 163 1 2

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 17 (position 15384362)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTGGTCTTCCAGGATCTGAGGGACCTGCTGGAATTCCAGGTCCTTCT[G/T]GACCTCCCGGCCCACCTGGTCCTCCTGGTGAGGTCATCTTTGAGAAGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12685
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091021 Nonsense 551 655 3 3
ENSDART00000123817 Nonsense 141 163 1 2
Genomic Location:
Chromosome 17 (position 15384195)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACCTTATCCCCCATCTGGTACTCCAATTAAGTTTGACCAGGTTGTGTA[T/G]AAYGCAGAGCAGCAYTATGATCCAGAGACAGGTATTTTCACCTGCCACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zlgr86d4