lmo4b

Ensembl ID:
ENSDARG00000054749
ZFIN ID:
ZDB-GENE-030131-3570
Description:
LIM domain transcription factor LMO4 [Source:RefSeq peptide;Acc:NP_997854]
Human Orthologue:
LMO4
Human Description:
LIM domain only 4 [Source:HGNC Symbol;Acc:6644]
Mouse Orthologue:
Lmo4
Mouse Description:
LIM domain only 4 Gene [Source:MGI Symbol;Acc:MGI:109360]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8463 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40693 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa8463
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076997 Essential Splice Site 112 165 4 5
Genomic Location:
Chromosome 6 (position 25678448)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATGTGCTAAGGAKTGTGTGTAATGTAGTTCTTTTGTTTTGTTTCCTGC[A/T]GTGTTTCACATGTTCTACCTGCCGGAACCGGCTTGTCCCTGGKGACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40693
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076997 Nonsense 154 165 4 5
Genomic Location:
Chromosome 6 (position 25678320)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAACACGACAGACCCACAGCACTCATCAATGGCCATTTGAGTTCATTG[C/T]AGACTAACCCTCTACTGCCTGACCAGAAAGTAAGAGCCATAGTCGGTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link