LOC556987

Ensembl ID:
ENSDARG00000054744
Human Orthologues:
GJA10, GJA9, GJC1, GJC2, GJD2, GJD3, GJD4
Human Descriptions:
gap junction protein, alpha 10, 62kDa [Source:HGNC Symbol;Acc:16995]
gap junction protein, alpha 9, 59kDa [Source:HGNC Symbol;Acc:19155]
gap junction protein, delta 2, 36kDa [Source:HGNC Symbol;Acc:19154]
gap junction protein, delta 3, 31.9kDa [Source:HGNC Symbol;Acc:19147]
gap junction protein, delta 4, 40.1kDa [Source:HGNC Symbol;Acc:23296]
gap junction protein, gamma 1, 45kDa [Source:HGNC Symbol;Acc:4280]
gap junction protein, gamma 2, 47kDa [Source:HGNC Symbol;Acc:17494]
Mouse Orthologues:
Gja10, Gjc1, Gjc2, Gjd2, Gjd3, Gjd4
Mouse Descriptions:
gap junction protein, alpha 10 Gene [Source:MGI Symbol;Acc:MGI:1339969]
gap junction protein, delta 2 Gene [Source:MGI Symbol;Acc:MGI:1334209]
gap junction protein, delta 3 Gene [Source:MGI Symbol;Acc:MGI:2384150]
gap junction protein, delta 4 Gene [Source:MGI Symbol;Acc:MGI:2444990]
gap junction protein, gamma 1 Gene [Source:MGI Symbol;Acc:MGI:95718]
gap junction protein, gamma 2 Gene [Source:MGI Symbol;Acc:MGI:2153060]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28485 Nonsense Mutation detected in F1 DNA During 2017
sa32045 Nonsense Available for shipment Available now
sa32046 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa28485
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076996 Nonsense 102 354 1 1
Genomic Location (Zv9):
Chromosome 15 (position 30574753)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31396460
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCAACGCCCTCCATCTTCTACATCATCTATGTGCTGCACAAAATCACC[A/T]AAGATGAGAAGATGGAGACGGAGAGGATCCACGCAGAGGCCAGTCACCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32045
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076996 Nonsense 308 354 1 1
Genomic Location (Zv9):
Chromosome 15 (position 30575372)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31397079
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGCAGTCTTCAACAACCACTCTGTCTCAGGAGAAGACCGGGACGGCTT[T/A]GCTTTCACATGGTCCTGTCATCTCTTTTGAGACCGACTCGACTCTTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32046
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076996 Nonsense 346 354 1 1
Genomic Location (Zv9):
Chromosome 15 (position 30575485)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31397192
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAACCCTGAGGAGAGGGAACGCATGAGGGTCAAATTGGCCAACATGGTT[A/T]GATTTACTGGTAAAAAGTCTTGGCTGTGATGTGTACTGATGGATTTTAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Refractive error: A genome-wide association study identifies a susceptibility locus for refractive errors and myopia at 15q14. (View Study)
  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link