prkg2

Ensembl ID:
ENSDARG00000054741
ZFIN ID:
ZDB-GENE-060531-80
Description:
cGMP-dependent protein kinase 2 [Source:RefSeq peptide;Acc:NP_001098749]
Human Orthologue:
PRKG2
Human Description:
protein kinase, cGMP-dependent, type II [Source:HGNC Symbol;Acc:9416]
Mouse Orthologue:
Prkg2
Mouse Description:
protein kinase, cGMP-dependent, type II Gene [Source:MGI Symbol;Acc:MGI:108173]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33668 Nonsense Mutation detected in F1 DNA During 2017
sa33667 Nonsense Available for shipment Available now
sa17874 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33668
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076929 Nonsense 155 768 1 18
Genomic Location (Zv9):
Chromosome 5 (position 41303717)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39097609
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGAACGTATGATTCCAGTGGGATTCCAAAGTTCTACTTCGAGAGCGCA[C/T]GAGTCTGGAAAGAGCAGAGGTGGGACCTTTGATTTATTTTATGTTTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33667
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076929 Nonsense 174 768 2 18
Genomic Location (Zv9):
Chromosome 5 (position 41301237)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39095129
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTTCCAACAGTGTAAAGAAGCTCCTGACAGATGCTCTGAATAAGAAC[C/T]AGTATCTGAGGAGACTGGAAGTGCAGCAGGTCAAAGACATGGTCGAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17874
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076929 Essential Splice Site 521 768 11 18
Genomic Location (Zv9):
Chromosome 5 (position 41289714)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39083606
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTCTGAGAGGAGGATCTTGCTGGAGACAAACTGTCCTTTCATTGTGAA[G/A]TATGTTAGTCTAGCATGATCATACTGTCGTAGAAATGTCYGTTTAGTGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Height: Meta-analysis of genome-wide scans for human adult stature identifies novel Loci and associations with measures of skeletal frame size. (View Study)
  • HIV-1 viral setpoint: Genomewide association study for determinants of HIV-1 acquisition and viral set point in HIV-1 serodiscordant couples with quantified virus exposure. (View Study)
  • Pubertal anthropometrics: Genome-wide association and longitudinal analyses reveal genetic loci linking pubertal height growth, pubertal timing and childhood adiposity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link