si:ch211-242b18.1

Ensembl ID:
ENSDARG00000054723
ZFIN ID:
ZDB-GENE-030131-1518
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RIJ0]
Human Orthologue:
PDE4DIP
Human Description:
phosphodiesterase 4D interacting protein [Source:HGNC Symbol;Acc:15580]
Mouse Orthologue:
Pde4dip
Mouse Description:
phosphodiesterase 4D interacting protein (myomegalin) Gene [Source:MGI Symbol;Acc:MGI:1891434]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29407 Nonsense Mutation detected in F1 DNA During 2017
sa16686 Essential Splice Site Available for shipment Available now
sa15948 Nonsense Available for shipment Available now
sa18459 Nonsense Available for shipment Available now
sa37098 Nonsense Mutation detected in F1 DNA During 2017
sa462 Nonsense Confirmed mutation in F2 line During 2017
sa12868 Nonsense Available for shipment Available now
sa37099 Nonsense Mutation detected in F1 DNA During 2017
sa32308 Essential Splice Site Available for shipment Available now
sa29408 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29407
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076946 Nonsense 133 2016 6 42
ENSDART00000136651   None 92 None 5
ENSDART00000138338 Nonsense 95 2431 3 38

The following transcripts of ENSDARG00000054723 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 34616643)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34689156
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGTCTGAGCAGTCAGAATGAGGTGGAGGTCCAGCGCCGCTGTGAGGAA[C/T]GACAGCAGGAGACCGGACACATACAAGAGATTCTGCAGACTAAGATCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16686
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076946 Essential Splice Site 208 2016 7 42
ENSDART00000136651   None 92 None 5
ENSDART00000138338 Essential Splice Site 170 2431 4 38

The following transcripts of ENSDARG00000054723 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 34617182)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34689695
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGTTTGCCTGTCATGGCACAGTATGAAGAGATGGCAAAGAAGGACAGG[T/G]AAAATATTACAGCAGTGCCATTCAAAACATCATTTTGTTATTCTATKGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15948
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076946 Nonsense 280 2016 10 42
ENSDART00000136651   None 92 None 5
ENSDART00000138338 Nonsense 611 2431 7 38

The following transcripts of ENSDARG00000054723 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 34624629)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34697142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTAAATATTTGTGTGATCTGTCNNTGTTTCAGAGGTTGATTGAGGAG[C/T]AGCAATGTCATCTGGCGGAGTATGAAAACGCAGCGGGACAGTGTGTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18459
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076946 Nonsense 359 2016 11 42
ENSDART00000136651   None 92 None 5
ENSDART00000138338 Nonsense 690 2431 8 38

The following transcripts of ENSDARG00000054723 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 34625030)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34697543
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGAGACAACAATACAGACCTTGGGTGACTCACTCWGTACTAAAGAYTA[T/A]GAGGTATGTCTGCAAMTRAAGCAGTGATGAGAATTTCAATTAATCCTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37098
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076946 Nonsense 830 2016 19 42
ENSDART00000136651   None 92 None 5
ENSDART00000138338 Nonsense 1156 2431 16 38

The following transcripts of ENSDARG00000054723 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 34629625)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34702138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACCTTCAGATGCAGTTGGTGGAGCCATCTGATTTACCACTGGTAGAG[C/T]GACTGACTCAAGAGCTGCAGCTGCTGAGAGAGAAGGTGGAAAGTCAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa462
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076946 Nonsense 839 2016 19 42
ENSDART00000136651   None 92 None 5
ENSDART00000138338 Nonsense 1165 2431 16 38

The following transcripts of ENSDARG00000054723 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 34629652)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34702165
KASP Assay ID:
554-0167.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTGATTTACCACTGGTAGAGCGACTGACTCAAGAGCTGCAGCTGCTG[A/T]GAGAGAAGGTGGAAAGTCAGGAAGCGTCCTGCAATAATCACAAGGTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12868
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076946 Nonsense 1076 2016 25 42
ENSDART00000136651   None 92 None 5
ENSDART00000138338 Nonsense 1402 2431 22 38

The following transcripts of ENSDARG00000054723 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 34639575)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34712088
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTCTTGTCTTTYGTWTAGCGGAAACATCGGTACAGCAGGACAGTAAG[C/T]AGGTCCAGGTGGACATTCAGGATCTGGGCTATGAGACGTGTGGCCGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076946 Nonsense 1469 2016 30 42
ENSDART00000136651   None 92 None 5
ENSDART00000138338 Nonsense 1818 2431 26 38

The following transcripts of ENSDARG00000054723 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 34652852)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34725365
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGTCCACCAACACCTGTCCTAGCATACACTGCACACCACGTAGACCAT[T/A]GGAAACCCAGGAACAAACAGGTAGGAAGAGTAAGAGACTATCAGTTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32308
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076946 Essential Splice Site 1756 2016 35 42
ENSDART00000136651   None 92 None 5
ENSDART00000138338 Essential Splice Site 2189 2431 32 38

The following transcripts of ENSDARG00000054723 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 34657564)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34730077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACTTCAAGTGTACAAGAGAGTCTGTGGCACTGCTGAGAGCAATGCAGG[T/C]AAGAAACAAATGCACCTGTCCGAAACTCTTCATCAGACATTGCTAACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29408
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076946 Nonsense 1954 2016 40 42
ENSDART00000136651   None 92 None 5
ENSDART00000138338 Nonsense 2387 2431 37 38

The following transcripts of ENSDARG00000054723 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 34662820)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34735333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGTCTTTGAGAAAGGAGGTCATCGCATTGAGGTGCAAGTTGTCAGAA[C/T]AAGAGCAGCTTCTCAGGGACACGATGGAGAATCTGAGGGCCTCCAGTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link