or118-2

Ensembl ID:
ENSDARG00000054718
ZFIN ID:
ZDB-GENE-070806-81
Description:
odorant receptor, family F, subfamily 118, member 2 [Source:RefSeq peptide;Acc:NP_001122052]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17325 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17325
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076965 Nonsense 265 307 2 2
ENSDART00000122202 Nonsense 267 308 2 2
ENSDART00000132455 Nonsense 269 312 1 1
Genomic Location:
Chromosome 15 (position 30620354)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACTCTTTTTCCACTCGTTGCACATCGCTCTGAAAGTGTTCCAGCTTA[T/A]CTTCGKAGAGTGTTTTCTATAACAGTTTTTGTMTTTCCTCCTATTATAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9s80ecjj