im:7153552

Ensembl ID:
ENSDARG00000054707
ZFIN ID:
ZDB-GENE-050809-39
Human Orthologue:
DHX8
Human Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 8 [Source:HGNC Symbol;Acc:2749]
Mouse Orthologue:
Dhx8
Mouse Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 8 Gene [Source:MGI Symbol;Acc:MGI:1306823]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22114 Nonsense Mutation detected in F1 DNA During 2014
sa22113 Nonsense Mutation detected in F1 DNA During 2014
sa6254 Nonsense Mutation detected in F1 DNA During 2014
sa13601 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22114
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066282 Nonsense 89 1210 3 23
Genomic Location:
Chromosome 12 (position 29157934)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTCGTCTCATTCAAACAATGCGCCCTCCTGCAAAAGCATCTACCAGT[A/T]AAGGTAAGTGCATTTTGGATCAGTTTACAGAATAGCAGCTCATATTGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22113
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066282 Nonsense 597 1210 13 23
Genomic Location:
Chromosome 12 (position 29151227)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTCAGGGAAGACCACTCAGATCACACAATACCTGGCAGAAGCAGGATA[C/A]ACCACACGAGGGAAGATTGGGTGCACACAACCCAGAAGAGTGGCTGCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6254
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066282 Nonsense 746 1210 15 23
Genomic Location:
Chromosome 12 (position 29147266)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTACATACCCGGTAGAGGTTTTGTATACAAAAGAACCTGAAACTGACTA[T/A]CTGGATGCCAGTCTGATCACAGTCATGCAGATTCACCTCACTGAACCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13601
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066282 Nonsense 1060 1210 21 23
Genomic Location:
Chromosome 12 (position 29144069)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAACAACAAGTTTTYYAACCCCTGGTGTTACGAGAACTTCATTCAAGYC[C/T]GATCTCTYCGACGTGCACAGGATATCCGCAAACAGATGCTGGGCATCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/orq2bc69