prdm8b

Ensembl ID:
ENSDARG00000054683
ZFIN ID:
ZDB-GENE-060526-174
Description:
PR domain zinc finger protein 8 [Source:RefSeq peptide;Acc:NP_001098575]
Human Orthologue:
PRDM8
Human Description:
PR domain containing 8 [Source:HGNC Symbol;Acc:13993]
Mouse Orthologue:
Prdm8
Mouse Description:
PR domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:1924880]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31467 Nonsense Available for shipment Available now
sa16172 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31467
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097870 Nonsense 238 570 3 3
ENSDART00000121460 Nonsense 238 570 4 4
Genomic Location (Zv9):
Chromosome 5 (position 41113306)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 38907198
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCACAGGACGGAAAGCCATCCACAGACTTCCATAATCTGGCCAGGGATT[T/A]GGAGAATAACCGAACCAGTCCTCCGAGTGACAAAGAGGCAGAGATCCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16172
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097870 Nonsense 546 570 3 3
ENSDART00000121460 Nonsense 546 570 4 4
Genomic Location (Zv9):
Chromosome 5 (position 41114229)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 38908121
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAAAAGGAGTTTGCCATGGAACCTCTAGTTAAAAGAAGGAGAGAGGAA[A/T]AATTAAAGTGTCCAATCTGTAAWGAGTCTTTCAGGGAGCGACATCACCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link